FLT3c.1793_1794insCCTTCCTGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGALikely pathogenic

Print report

Variant interpretation report

FLT3 c.1793_1794insCCTTCCTGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGA, p.(Tyr597_Glu598insAspLeuProValThrGlySerSerAspAsnGluTyrPheTyrValAspPheArgGluTyr)

NM_004119.3:c.1793_1794insCCTTCCTGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGA NP_004110.2:p.(Tyr597_Glu598insAspLeuProValThrGlySerSerAspAsnGluTyrPheTyrValAspPheArgGluTyr) View identifiers

Classification

Likely pathogenic

Variant description:

No variant summary was recorded for this case.

Five-step scale from benign to pathogenic. This variant is likely pathogenic. Select a step to read what it means.

Likely pathogenic.A likely pathogenic classification under the recorded framework.

In plain language

Gene-level background from the recorded interpretation.

About FLT3

No gene-level summary was recorded for this case.

Key facts

Evidence used: 2 moderate (pathogenic) · 2 supporting (pathogenic)
Expert rules: Local FLT3 ITD / activating length-mutation framework
Pipeline record: 14 Jun 2026

Evidence considered

View criteria

Applied evidence criteria

PS3 (supporting): OncoKB reports exact-variant Likely Oncogenic with Likely Gain-of-function for p.(Y597_E598insDLPVTGSSDNEYFYVDFREY). The broader FLT3 ITD literature (PMID:9737679, PMID:11090077, PMID:11756186) establishes constitutive activation of the FLT3 kinase as the canonical mechanism for juxtamembrane ITDs. Per the local FLT3 custom framework, this exact-variant OncoKB functional/mechanistic annotation together with class-level FLT3 ITD activation literature is sufficient for PS3_Supporting.
PM1 (moderate): The variant maps to codons 597-598 in the FLT3 juxtamembrane domain, which lies within the well-established ITD activating hotspot cluster at codons 589-599. Mutalyzer normalization (NM_004119.3:c.1793_1794ins[CCTTCCT;1741_1793]) confirms this is a tandem duplication event producing an in-frame ITD in the canonical juxtamembrane region. This region is a critical functional domain where no benign population variation is observed (absent from gnomAD v2.1 and v4.1). The literature consistently identifies this region as a recurrent mutational hotspot in AML where ITDs constitutively activate FLT3 kinase (PMID:9737679 reported 47/51 FLT3 ITDs in codons 589-599). Per the local FLT3 custom framework, PM1_Moderate is applicable.
PM2 (supporting): The variant is absent from gnomAD v2.1 and v4.1 (population databases encompassing >250,000 alleles), meeting the PM2 threshold of allele frequency <0.1% in all populations. This variant has not been observed in any healthy population cohort.
PM5 (moderate): Per the local FLT3 custom framework extension of PM5 beyond missense-only wording: this is a novel in-frame ITD at codons 597-598 that falls within the established activating juxtamembrane ITD hotspot class (codons 589-599). Multiple prior pathogenic/oncogenic FLT3 ITDs are established for this hotspot (PMID:9737679 documented 47/51 ITDs in this region). The exact inserted sequence need not have been previously characterized; the event is clearly an ITD / activating length-mutation analogue in the same hotspot mechanism as prior established pathogenic FLT3 ITDs.

LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.

01The reasoning

How it was classified

The recorded framework is Local FLT3 ITD / activating length-mutation framework. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.

Recorded applied criteria

The applied criteria and their strengths are shown as assessed under the stated framework.

Pathogenic evidence criteria: 4 Benign evidence criteria: 0

Pathogenic criteria applied · 4

PS3Supporting

PS3 · supporting

OncoKB reports exact-variant Likely Oncogenic with Likely Gain-of-function for p.(Y597_E598insDLPVTGSSDNEYFYVDFREY). The broader FLT3 ITD literature (PMID:9737679, PMID:11090077, PMID:11756186) establishes constitutive activation of the FLT3 kinase as the canonical mechanism for juxtamembrane ITDs. Per the local FLT3 custom framework, this exact-variant OncoKB functional/mechanistic annotation together with class-level FLT3 ITD activation literature is sufficient for PS3_Supporting.

PM1Moderate

PM1 · moderate

The variant maps to codons 597-598 in the FLT3 juxtamembrane domain, which lies within the well-established ITD activating hotspot cluster at codons 589-599. Mutalyzer normalization (NM_004119.3:c.1793_1794ins[CCTTCCT;1741_1793]) confirms this is a tandem duplication event producing an in-frame ITD in the canonical juxtamembrane region. This region is a critical functional domain where no benign population variation is observed (absent from gnomAD v2.1 and v4.1). The literature consistently identifies this region as a recurrent mutational hotspot in AML where ITDs constitutively activate FLT3 kinase (PMID:9737679 reported 47/51 FLT3 ITDs in codons 589-599). Per the local FLT3 custom framework, PM1_Moderate is applicable.

PM2Supporting

PM2 · supporting

The variant is absent from gnomAD v2.1 and v4.1 (population databases encompassing >250,000 alleles), meeting the PM2 threshold of allele frequency <0.1% in all populations. This variant has not been observed in any healthy population cohort.

PM5Moderate

PM5 · moderate

Per the local FLT3 custom framework extension of PM5 beyond missense-only wording: this is a novel in-frame ITD at codons 597-598 that falls within the established activating juxtamembrane ITD hotspot class (codons 589-599). Multiple prior pathogenic/oncogenic FLT3 ITDs are established for this hotspot (PMID:9737679 documented 47/51 ITDs in this region). The exact inserted sequence need not have been previously characterized; the event is clearly an ITD / activating length-mutation analogue in the same hotspot mechanism as prior established pathogenic FLT3 ITDs.

Benign criteria applied · 0

No benign criterion marked as applied in the recorded assessment.

Recorded classification: Likely pathogenic

Two Moderate criteria (PM1, PM5) plus two Supporting criteria (PS3, PM2) are met. The local FLT3 ITD custom framework classifies '2 Moderate + >=2 Supporting' as Likely Pathogenic. No benign criteria are met.

02The sources

Evidence at a glance

Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.

gnomAD v4.1

gnomAD v2.1

Population frequency

Not recorded

gnomAD v4.1 allele counts were not recorded for this variant.

gnomAD v2.1

Absent from gnomAD v2.1.

Applied · PM2 →

gnomAD v4.1 ↗gnomAD v2.1 ↗gnomAD-Canada ↗

SpliceAI score

0.450 maximum delta

Recorded SpliceAI maximum delta score: 0.450. Refer to the recorded PP3/BP4 rationale for interpretation.

No listed criterion applied SpliceAI ↗

ClinVar submissions

Not recorded

A ClinVar laboratory submission summary was not recorded.

Context only ClinVar ↗

Functional evidence

Statement recorded

OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Gain-of-function; curated oncogenicity label: Likely Oncogenic.

Applied · PS3 → OncoKB ↗

COSMIC

Cancer Hotspots

Somatic evidence

No matching record reported

This variant has not previously been reported in somatic cancers (COSMIC).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.

Context only

COSMIC ↗Cancer Hotspots ↗

For specialists

Technical detail

ACMG/AMP criteria under Local FLT3 ITD / activating length-mutation framework, with the data and sources behind each one.

29 criteria with recorded statuses: 4 met · 3 not met · 0 not assessed · 22 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.

Pathogenic

PVS1 PS1 PS2 PS3 PS4 PM1 PM2 PM3 PM4 PM5 PM6 PP1 PP2 PP3 PP4 PP5 PS5

Benign

BA1 BS1 BS2 BS3 BS4 BP1 BP2 BP3 BP4 BP5 BP6 BP7

Met Not met Not assessed Not applicable

NM_004119.3:c.1792_1793insACCTTCCTGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATG (p.Tyr597_Glu598insAspLeuProValThrGlySerSerAspAsnGluTyrPheTyrValAspPheArgGluTyr) is a novel 20-amino-acid in-frame internal tandem duplication (ITD) in the FLT3 juxtamembrane domain at codons 597-598, within the well-established ITD activating hotspot (codons 589-599).

PM1_Moderate is met because the variant maps to the FLT3 juxtamembrane ITD hotspot (codons 589-599), a critical functional domain where recurrent activating ITDs have been established and where no benign population variation is observed in gnomAD. PMID:9737679 documented 47 of 51 FLT3 ITDs in this same codon cluster with constitutive kinase activation.

PM5_Moderate is met per the local FLT3 custom framework extension: this is a novel ITD in the same established activating juxtamembrane hotspot class as prior pathogenic FLT3 ITDs. The exact inserted sequence need not have been previously characterized; the event is clearly an ITD analogue in the same hotspot mechanism as established activating FLT3 mutations.

PS3_Supporting is met because OncoKB reports exact-variant Likely Oncogenic with Likely Gain-of-function for p.(Y597_E598insDLPVTGSSDNEYFYVDFREY), and the broader FLT3 ITD literature (PMID:9737679, PMID:11090077, PMID:11756186) establishes constitutive kinase activation as the canonical mechanism for juxtamembrane ITDs.

PM2_Supporting is met because the variant is absent from gnomAD v2.1 and v4.1 (allele frequency 0.0% in all populations).

The variant is absent from ClinVar and COSMIC. SpliceAI predicts an acceptor gain (delta 0.45), but this is of uncertain clinical significance for an in-frame ITD with an established gain-of-function mechanism.

Applying the local FLT3 ITD / activating length-mutation framework with generic ACMG/AMP 2015 final combination rules: 2 Moderate criteria (PM1, PM5) plus 2 Supporting criteria (PS3, PM2) meets the threshold for Likely Pathogenic (2 Moderate + >=2 Supporting).

Met · 4

PS3 SupportingOncoKB reports exact-variant Likely Oncogenic with Likely Gain-of-function for p.(Y597_E598insDLPVTGSSDNEYFYVDFREY). The broader FLT3 ITD literature (PMID:9737679, PMID:11090077, PMID:11756186) establishes constitutive activation of the FLT3 kinase as the canonical mechanism for juxtamembrane ITDs. Per the local FLT3 custom framework, this exact-variant OncoKB functional/mechanistic annotation together with class-level FLT3 ITD activation literature is sufficient for PS3_Supporting. Details ▾Hide ▴

Evidence considered

OncoKB exact-variant annotation: Likely Oncogenic / Likely Gain-of-function.
Class-level literature establishes gain-of-function as the canonical mechanism for FLT3 juxtamembrane ITDs.

Still missing

No dedicated standalone wet-lab functional assay for this exact inserted sequence.

Sources

oncokb ↗PMID:9737679 ↗PMID:11090077 ↗PMID:11756186 ↗97376791109007711756186

PM1 ModerateThe variant maps to codons 597-598 in the FLT3 juxtamembrane domain, which lies within the well-established ITD activating hotspot cluster at codons 589-599. Mutalyzer normalization (NM_004119.3:c.1793_1794ins[CCTTCCT;1741_1793]) confirms this is a tandem duplication event producing an in-frame ITD in the canonical juxtamembrane region. This region is a critical functional domain where no benign population variation is observed (absent from gnomAD v2.1 and v4.1). The literature consistently identifies this region as a recurrent mutational hotspot in AML where ITDs constitutively activate FLT3 kinase (PMID:9737679 reported 47/51 FLT3 ITDs in codons 589-599). Per the local FLT3 custom framework, PM1_Moderate is applicable. Details ▾Hide ▴

Evidence considered

Variant maps to codon 597-598 within the FLT3 juxtamembrane ITD hotspot (codons 589-599).
Mutalyzer normalization confirms tandem duplication mechanism consistent with ITD.
Absent from gnomAD v2.1 and v4.1
confirming no benign variation in this region.
PMID:9737679 reported 47/51 FLT3 ITDs localize to codon 589-599 with constitutive kinase activation.

Sources

gnomad_v2 ↗gnomad_v4 ↗PMID:9737679 ↗PMID:11090077 ↗PMID:11756186 ↗vcep_flt3_itd_hotspot_and_functiononcokb ↗97376791109007711756186

PM2 SupportingThe variant is absent from gnomAD v2.1 and v4.1 (population databases encompassing >250,000 alleles), meeting the PM2 threshold of allele frequency <0.1% in all populations. This variant has not been observed in any healthy population cohort. Details ▾Hide ▴

Evidence considered

Absent from gnomAD v2.1 (exomes).
Absent from gnomAD v4.1 (exomes + genomes).
Allele frequency 0.0% in all populations.

Sources

gnomad_v2 ↗gnomad_v4 ↗

PM5 ModeratePer the local FLT3 custom framework extension of PM5 beyond missense-only wording: this is a novel in-frame ITD at codons 597-598 that falls within the established activating juxtamembrane ITD hotspot class (codons 589-599). Multiple prior pathogenic/oncogenic FLT3 ITDs are established for this hotspot (PMID:9737679 documented 47/51 ITDs in this region). The exact inserted sequence need not have been previously characterized; the event is clearly an ITD / activating length-mutation analogue in the same hotspot mechanism as prior established pathogenic FLT3 ITDs. Details ▾Hide ▴

Evidence considered

Novel in-frame ITD in the established juxtamembrane hotspot (codons 589-599).
PMID:9737679: 47/51 FLT3 ITDs cluster in codons 589-599 with constitutive activation.
PMID:12384447: demonstrates that activating FLT3 length mutations are not restricted to one exact sequence.
Prior pathogenic/oncogenic FLT3 ITDs are established for the same hotspot mechanism class.

Sources

PMID:9737679 ↗PMID:11090077 ↗PMID:11756186 ↗PMID:12384447 ↗vcep_flt3_itd_hotspot_and_functionvcep_flt3_oncokb_guidanceoncokb ↗9737679110900771175618612384447

Not met · 3 · evaluated, threshold not reached

BA1 The variant is absent from gnomAD (v2.1 and v4.1). The BA1 threshold of >1% allele frequency is not met. Details ▾Hide ▴

Evidence considered

Allele frequency 0.0% in all populations.

Sources

gnomad_v2 ↗gnomad_v4 ↗

BS1 The variant is absent from gnomAD. The BS1 threshold of >0.3% allele frequency is not met. Details ▾Hide ▴

Evidence considered

Allele frequency 0.0% in all populations.

Sources

gnomad_v2 ↗gnomad_v4 ↗

BP3 Per the local FLT3 custom framework, BP3 is not applied to FLT3 in-frame ITDs or activating length mutations in the juxtamembrane hotspot region because this region has a known activating disease mechanism and recurrent pathogenic/oncogenic variation. The insertion is not in a repetitive region without known function. Details ▾Hide ▴

Evidence considered

FLT3 juxtamembrane domain is a well-established activating functional domain
recurrent pathogenic ITDs are documented in this region.

Sources

vcep_flt3_itd_hotspot_and_functionPMID:9737679 ↗9737679

Not applicable · 22· recorded as not applicable Show reasons ▾Hide reasons ▴

PVS1 N/AThis is an in-frame insertion in the juxtamembrane domain, not a nonsense, frameshift, or canonical ±1,2 splice site variant. PVS1 is not applicable to in-frame ITD events under ClinGen SVI PVS1 guidelines (PMC6185798). Details ▾Hide ▴

Evidence considered

In-frame insertion
variant bucket classified as 'other' per PVS1 decision tree.

Sources

pvs1_generic_framework ↗

PS1 N/APS1 applies to different nucleotide changes at the same amino acid position with prior pathogenic classification. This variant is a 60-bp in-frame insertion, not a single-nucleotide substitution. Details ▾Hide ▴

Evidence considered

In-frame insertion variant type excludes PS1 applicability.

PS2 N/ANo de novo data are available for this variant. Details ▾Hide ▴

Evidence considered

No de novo observations reported in any reviewed source.

PS4 N/ANo case-control or observational cohort data are available for this variant in a germline context. Details ▾Hide ▴

Evidence considered

No prevalence data in affected vs. unaffected populations.

PM3 N/ASkipped per instructions — PM3 was explicitly excluded from assessment. Details ▾Hide ▴

No further detail was recorded.

PM4 N/APer the local FLT3 custom framework, PM4 is not separately applied when PM1 and PM5 already capture the hotspot and established activating mechanism for this juxtamembrane ITD event. The protein length change rationale is already represented by PM1 and PM5. Details ▾Hide ▴

Evidence considered

Local FLT3 framework specifies that PM4 should not be stacked with PM1/PM5 for canonical juxtamembrane ITD events.

Sources

vcep_flt3_itd_hotspot_and_function

PM6 N/ANo de novo data are available for this variant. Details ▾Hide ▴

Evidence considered

No de novo observations reported in any reviewed source.

PP1 N/ANo segregation data are available for this variant. Details ▾Hide ▴

Evidence considered

No family-based segregation studies reported in any reviewed source.

PP2 N/APP2 applies to missense variants in genes where missense is a common disease mechanism. This is an in-frame insertion (ITD), not a missense substitution. Details ▾Hide ▴

Evidence considered

Variant type (in-frame insertion/ITD) excludes PP2 applicability.

PP3 N/ASpliceAI predicts an acceptor gain with delta score 0.45, but the established pathogenic mechanism for FLT3 juxtamembrane ITDs is gain-of-function via disruption of the autoinhibitory JM domain leading to constitutive kinase activation, not aberrant splicing. The SpliceAI signal is of uncertain relevance for an in-frame ITD where the primary functional effect is well-characterized at the protein level. PP3 is not separately applied. Details ▾Hide ▴

Evidence considered

SpliceAI max delta 0.45 (acceptor gain)
but of uncertain clinical relevance for in-frame ITD with established gain-of-function mechanism.

Sources

spliceai ↗

PP4 N/ANo phenotype-specific data are available for this variant in a clinical diagnostic setting. Details ▾Hide ▴

Evidence considered

No patient phenotype data available.

PP5 N/AThis variant is absent from ClinVar. No reputable source has classified this variant as pathogenic. Details ▾Hide ▴

Evidence considered

Variant is absent from ClinVar.

Sources

clinvar ↗

BS2 N/ANo observation in healthy adult individuals is documented for this variant. Details ▾Hide ▴

Evidence considered

No healthy adult observation data available.

BS3 N/ANo well-established in vitro or in vivo functional studies demonstrating no damaging effect are available for this variant. The available functional evidence supports a gain-of-function mechanism. Details ▾Hide ▴

Evidence considered

No benign functional evidence identified.

BS4 N/ANo segregation data are available to assess lack of cosegregation with disease. Details ▾Hide ▴

Evidence considered

No segregation data available.

BP1 N/ABP1 applies to missense variants in genes where a truncating mechanism is the primary cause of disease. This is an in-frame insertion (ITD), not a missense substitution. Details ▾Hide ▴

Evidence considered

Variant type (in-frame insertion/ITD) excludes BP1 applicability.

BP2 N/ANo observation in trans with a known pathogenic variant is available for this variant. Details ▾Hide ▴

Evidence considered

No in trans data available.

BP4 N/ANo multiple lines of computational evidence suggest no impact on gene product. SpliceAI delta score of 0.45 does not support a benign interpretation, and REVEL/BayesDel are not available for insertions. Details ▾Hide ▴

Evidence considered

SpliceAI max delta 0.45 does not support benign interpretation
REVEL and BayesDel not applicable for insertions.

Sources

spliceai ↗

BP5 N/AThis variant is absent from ClinVar. No reputable source has classified this variant as benign. Details ▾Hide ▴

Evidence considered

Variant is absent from ClinVar.

Sources

clinvar ↗

BP6 N/AThis variant is absent from ClinVar. No reputable source has classified this variant as benign. Details ▾Hide ▴

Evidence considered

Variant is absent from ClinVar.

Sources

clinvar ↗

BP7 N/ABP7 applies to synonymous (silent) variants. This is a 60-bp in-frame insertion resulting in a 20-amino-acid protein insertion. Details ▾Hide ▴

Evidence considered

In-frame insertion variant type excludes BP7 applicability.

PS5 N/APS5 is applicable only to recessive disorders. Details ▾Hide ▴

No further detail was recorded.

Identifiers

Gene: FLT3
Transcript: NM_004119.3
Coding (HGVS c.): NM_004119.3:c.1793_1794insCCTTCCTGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGA
Protein (HGVS p.): NP_004110.2:p.(Tyr597_Glu598insAspLeuProValThrGlySerSerAspAsnGluTyrPheTyrValAspPheArgGluTyr)
GRCh38: chr13:28034125 T>TTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGGTCACAGGAAGG
GRCh37: chr13:28608262 T>TTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGGTCACAGGAAGG

Gene diagram

Every interpreted variant in FLT3, mapped onto the exon structure of NM_004119.3. Select a row to find it on the plot.

FLT3NM_004119.3

Fetching transcript structure from UCSC…

Exons

—

Transcript span

—

Strand

—

Variants mapped

—

Source

UCSC ncbiRefSeqCurated

All variants in FLT3 — Select a row to find it on the plot; use the link to open its page.

	Protein	Location	Classification	Link

gnomAD v4.1 Allele count data not recorded

gnomAD v2.1 Allele count data not recorded

gnomAD-Canada v1.0 0 / 0 alleles AF 0 · 0 homozygotes · FAF 0

By genetic ancestry

gnomAD-Canada

AF 0 · 0 / 0 alleles · 0 hom

Statements

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

Open the gnomAD-Canada detail page →

SpliceAI and Pangolin

SpliceAI acceptor lossat +130 bp

0.060

SpliceAI acceptor gainat +9 bp

0.450

SpliceAI donor lossat +164 bp

0.030

SpliceAI donor gainat +0 bp

0.000

Pangolin splice lossmagnitude shown

-0.070

Pangolin splice gain

0.180

Other predictors

REVEL: Not available
BayesDel: Not available

How the predictions were used

Evidence considered

SpliceAI max delta 0.45 (acceptor gain)
but of uncertain clinical relevance for in-frame ITD with established gain-of-function mechanism.

Sources

spliceai ↗

Evidence considered

SpliceAI max delta 0.45 does not support benign interpretation
REVEL and BayesDel not applicable for insertions.

Sources

spliceai ↗

BP7 N/ABP7 applies to synonymous (silent) variants. This is a 60-bp in-frame insertion resulting in a 20-amino-acid protein insertion. Details ▾Hide ▴

Evidence considered

In-frame insertion variant type excludes BP7 applicability.

Statement

In silico

SpliceAI predicts possible splice impact for this variant (max delta score = 0.45).

5 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata. None of the listed paper records explicitly indicates that the variant is named.

Recorded publications

Flt3 mutations from patients with acute myeloid leukemia induce transformation of 32D cells mediated by the Ras and STAT5 pathways.

No paper-specific finding is recorded.

PMID 11090077 ↗
FLT3 internal tandem duplication mutations associated with human acute myeloid leukemias induce myeloproliferative disease in a murine bone marrow transplant model.

No paper-specific finding is recorded.

PMID 11756186 ↗
A new and recurrent activating length mutation in exon 20 of the FLT3 gene in acute myeloid leukemia.

No paper-specific finding is recorded.

PMID 12384447 ↗
FLT3 tyrosine kinase inhibitors in acute myeloid leukemia: clinical implications and limitations.

No paper-specific finding is recorded.

PMID 23631653 ↗
Internal tandem duplication of the FLT3 gene is a novel modality of elongation mutation which causes constitutive activation of the product.

No paper-specific finding is recorded.

PMID 9737679 ↗

Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.

gnomAD v4.1 Captured gnomAD v4.1 source record Open source ↗

gnomAD v2.1 Captured gnomAD v2.1 source record Open source ↗

SpliceAI Lookup Recorded maximum delta 0.450 Open source ↗

ClinVar Captured ClinVar source record Open source ↗

COSMIC Captured COSMIC source record Open source ↗

Cancer hotspots Captured Cancer Hotspots source record Open source ↗

OncoKB Captured OncoKB source record Open source ↗

All source links

Statements for reports

The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

ClinVar

This variant is absent from ClinVar.

In silico

SpliceAI predicts possible splice impact for this variant (max delta score = 0.45).

Functional

OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Gain-of-function; curated oncogenicity label: Likely Oncogenic.

Somatic

This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.