About CDKN2A
No gene-level summary was recorded for this case.
Previous versions
Variant interpretation report
CDKN2A c.9_32del, p.(Ala4_Pro11del)
Classification
Not classified
Variant description:
No variant summary was recorded for this case.
Five-step scale from benign to pathogenic. Select a step to read what it means.
Not classified yet.Select a step to read what it means.
In plain language
Gene-level background from the recorded interpretation.
Words with a dotted underline have a short definition. Hover or tap them.
LYFE Sciences is an AI system, and it can make mistakes.
Criteria may be applied incorrectly, sources may be misread, and a
confident-looking classification can still be wrong.
Double-check every criterion and its underlying evidence
before relying on any call.
01The reasoning
How it was classified
The recorded framework is Not recorded. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.
Recorded applied criteria
The applied criteria and their strengths are shown as assessed under the stated framework.
Pathogenic evidence criteria: 0
Benign evidence criteria: 4
Pathogenic criteria applied · 0
No pathogenic criterion marked as applied in the recorded assessment.
Benign criteria applied · 4
BS2Supporting
BS2 · supporting
One homozygote for this variant is observed in gnomAD v4.1 (153 alleles total, 1 homozygous individual). CDKN2A is a well-established dominant melanoma susceptibility gene; homozygous pathogenic variants would be expected to result in severe or lethal phenotypes. The observation of a homozygote in a large population database is inconsistent with a high-penetrance pathogenic variant and supports a benign interpretation.
BS3Supporting
BS3 · supporting
Well-established functional studies demonstrate no damaging effect on protein function. Parry & Peters (PMID:8668202) showed that the amino- and carboxy-terminal domains of p16, outside the ankyrin repeats, are dispensable for function. Schraml et al. (PMID:11159196) specifically reported that the 24-bp deletion mutant was functionally normal for CDK4 binding, citing Monzon et al. (1998). Both the 24-bp deletion and the reciprocal 24-bp insertion lie outside the ankyrin-repeat region critical for CDK4/CDK6 interaction.
BP3Supporting
BP3 · supporting
The 24-bp deletion occurs within a repetitive sequence region at the 5' end of CDKN2A exon 1. Schraml et al. (PMID:11159196) documented 25 possible deletion variants leading to the same sequence alteration within this repeat region, and noted that both 24-bp deletions and duplications occur in this unstable repeat. In-frame deletions in repetitive regions without known function meet BP3.
BP4Supporting
BP4 · supporting
SpliceAI predicts no significant splice impact (max delta score = 0.06). While REVEL and BayesDel are not applicable to deletions, the low SpliceAI score provides computational evidence against a splicing defect. However, this represents a single line of computational evidence, limiting strength to supporting.
Recorded classification: Not classified
No source classification-combination explanation was recorded.
02The sources
Evidence at a glance
Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.
gnomAD v4.1
gnomAD v2.1
Population frequency
153 / 1,606,464 alleles
gnomAD v4.1: 153 / 1,606,464 alleles. Recorded AF 9.52402e-05. Recorded homozygote count 1.
gnomAD v2.1
This variant is present in gnomAD v2.1 (AF= 0.000135726; MAF= 0.01357%, 36/265240 alleles, homozygotes = 0) and has highest observed frequency in the Admixed American population (AF= 0.000512762; MAF= 0.05128%, 18/35104 alleles, homozygotes = 0); grpmax FAF= 0.00033868.
gnomAD-Canada
Absent from gnomAD-Canada v1.0.
SpliceAI score
0.060 maximum delta
Recorded SpliceAI maximum delta score: 0.060. Refer to the recorded PP3/BP4 rationale for interpretation.
ClinVar submissions
14 reported laboratory submissions
13 Uncertain significance · 1 Likely benign.
Context only
ClinVar ↗
Functional evidence
Statement recorded
In progress — evidence not uploaded yet.
COSMIC
Cancer Hotspots
Somatic evidence
11 recorded samples
This variant has previously been reported in somatic cancers (COSMIC; COSV58687620, n = 11 times).
Cancer Hotspots
This variant does not lie in a statistically significant hotspot.
Context only
For specialists
Technical detail
ACMG/AMP criteria under Not recorded, with the data and sources behind each one.
28 criteria with recorded statuses: 4 met · 10 not met · 7 not assessed · 7 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.
Met
Not met
Not assessed
Not applicable
NM_000077.4:c.9_32del (p.Ala4_Pro11del) is an in-frame 24-bp deletion removing 8 amino acids from the N-terminus of p16 in CDKN2A.
This deletion does not qualify as a null variant under the ClinGen SVI PVS1 framework (PMC6185798) and PVS1 is not applicable.
The variant is present in gnomAD v2.1 at 36/265,240 alleles (AF=0.0136%) and in gnomAD v4.1 at 153/1,606,464 alleles (AF=0.0095%) including one homozygote. These population frequencies are inconsistent with a high-penetrance pathogenic variant in a dominant cancer predisposition gene.
One homozygote is observed in gnomAD v4.1 (BS2_supporting). Homozygosity for a pathogenic CDKN2A variant would be expected to produce a severe phenotype, and its presence in a population database argues against high penetrance pathogenicity.
Functional studies demonstrate no damaging effect on p16 function. The N-terminal domain outside the ankyrin repeats is dispensable (PMID:8668202), and the specific 24-bp deletion mutant shows normal CDK4 binding (PMID:11159196) (BS3_supporting).
The deletion occurs within a repetitive sequence region of CDKN2A exon 1 with 25 possible deletion variants yielding the same sequence alteration; both deletions and duplications have been documented at this site (BP3_supporting).
SpliceAI predicts no significant splicing impact (max delta score = 0.06) (BP4_supporting).
The variant has been observed in melanoma-affected families (PMID:10070944, PMID:16905682, PMID:25780468) and is reported as a variant of uncertain significance by 13 clinical laboratories in ClinVar, with one laboratory classifying it as likely benign. No expert panel has adjudicated this variant.
Applying generic ACMG/AMP 2015 combination rules (PMID:25741868): the criteria met are BS2_supporting, BS3_supporting, BP3_supporting, and BP4_supporting. Four supporting benign criteria would satisfy 'Likely Benign' classification (≥2 supporting benign). However, the presence of a homozygous individual in gnomAD, taken together with functional evidence of normal protein activity and location in a repetitive region, supports a classification of Likely Benign.
No criteria match.
Met · 4
BS2 SupportingOne homozygote for this variant is observed in gnomAD v4.1 (153 alleles total, 1 homozygous individual). CDKN2A is a well-established dominant melanoma susceptibility gene; homozygous pathogenic variants would be expected to result in severe or lethal phenotypes. The observation of a homozygote in a large population database is inconsistent with a high-penetrance pathogenic variant and supports a benign interpretation. Details ▾Hide ▴
Evidence considered
- gnomAD v4.1 contains 1 homozygote among 1
- 606
- 464 alleles. Homozygosity for a pathogenic CDKN2A variant in a population database is unexpected for a dominant
- high-penetrance cancer predisposition gene.
Sources
BS3 SupportingWell-established functional studies demonstrate no damaging effect on protein function. Parry & Peters (PMID:8668202) showed that the amino- and carboxy-terminal domains of p16, outside the ankyrin repeats, are dispensable for function. Schraml et al. (PMID:11159196) specifically reported that the 24-bp deletion mutant was functionally normal for CDK4 binding, citing Monzon et al. (1998). Both the 24-bp deletion and the reciprocal 24-bp insertion lie outside the ankyrin-repeat region critical for CDK4/CDK6 interaction. Details ▾Hide ▴
Evidence considered
- PMID:8668202: N-terminal domain outside ankyrin repeats dispensable for p16 function. PMID:11159196: 24-bp deletion mutant shows normal CDK4 binding in functional assay.
Sources
BP3 SupportingThe 24-bp deletion occurs within a repetitive sequence region at the 5' end of CDKN2A exon 1. Schraml et al. (PMID:11159196) documented 25 possible deletion variants leading to the same sequence alteration within this repeat region, and noted that both 24-bp deletions and duplications occur in this unstable repeat. In-frame deletions in repetitive regions without known function meet BP3. Details ▾Hide ▴
Evidence considered
- PMID:11159196: 24-bp deletion lies within a repetitive sequence with 25 possible deletion variants producing the same alteration
- both deletions and duplications at this site are documented
- consistent with repeat-region instability.
Sources
BP4 SupportingSpliceAI predicts no significant splice impact (max delta score = 0.06). While REVEL and BayesDel are not applicable to deletions, the low SpliceAI score provides computational evidence against a splicing defect. However, this represents a single line of computational evidence, limiting strength to supporting. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta score = 0.06
- indicating no predicted splice-altering effect.
Sources
Not met · 10 · evaluated, threshold not reached
PS3 Available functional evidence does not support a damaging effect for this variant. Parry & Peters (PMID:8668202) demonstrated that the amino-terminal domain of p16 outside the ankyrin repeats is dispensable for function. Schraml et al. (PMID:11159196) reported that this 24-bp deletion mutant was functionally normal for CDK4 binding, consistent with the deletion lying outside the ankyrin-repeat region. No well-established functional studies demonstrate a damaging effect for this variant. Details ▾Hide ▴
Evidence considered
- Functional study (PMID:8668202) shows N-terminal domain dispensable. Functional study (PMID:11159196) reports normal CDK4 binding for this in-frame deletion mutant.
Sources
PS4 The prevalence of this variant in affected individuals does not reach statistical significance over population frequency. It has been observed in 1 of 87 high-risk Queensland melanoma families (PMID:10070944), 3 UK melanoma cases in a population-based screen (PMID:25780468), and is listed among CDKN2A mutations in the GenoMEL consortium (PMID:16905682). However, it is also present in gnomAD v4.1 at 153/1,606,464 alleles (AF=0.0095%) including one homozygote, and in gnomAD v2.1 at 36/265,240 alleles (AF=0.0136%). The population frequency is inconsistent with a high-penetrance pathogenic variant. Details ▾Hide ▴
Evidence considered
- Observed in melanoma cases but also present in population databases at frequencies incompatible with high-penetrance melanoma predisposition.
Sources
PM1 This variant does not lie in a statistically significant mutational hotspot. The Cancer Hotspots database reports no significant hotspot at these residues, and the deletion spans residues 4-11 of the N-terminal region outside the ankyrin-repeat functional domain. Details ▾Hide ▴
Evidence considered
- Cancer Hotspots database: residue not significant
- exact variant not listed in hotspot catalog.
PM2 While the allele frequency in gnomAD v2.1 (0.0136%) is below the 0.1% PM2 threshold, the variant is present at 153 alleles in gnomAD v4.1 with one observed homozygote. For a dominant, high-penetrance melanoma predisposition gene, the presence of a homozygote in a population database and a non-trivial allele count across two major databases argues against PM2 application. This criterion is not met when considering the totality of population frequency data. Details ▾Hide ▴
Evidence considered
- gnomAD v2.1: 36/265
- 240 (AF=0.0136%)
- gnomAD v4.1: 153/1
- 606
- 464 (AF=0.0095%) with 1 homozygote. Population frequency inconsistent with PM2 for a dominant cancer predisposition gene.
Sources
PM4 This is an in-frame 24-bp deletion removing 8 amino acids (p.Ala4_Pro11del). While in-frame deletions in non-repeat regions can meet PM4, functional evidence demonstrates that the N-terminal domain of p16 outside the ankyrin repeats is dispensable (PMID:8668202), and the specific 24-bp deletion mutant shows normal CDK4 binding (PMID:11159196). Additionally, the variant is present in population databases at a frequency incompatible with a pathogenic protein-length change in a dominant cancer gene. PM4 is not met. Details ▾Hide ▴
Evidence considered
- In-frame deletion outside ankyrin-repeat domain
- functional evidence shows N-terminal domain dispensable and normal CDK4 binding
- population frequency inconsistent with pathogenic protein-length change.
Sources
PP3 In silico tools provide no evidence of pathogenicity. SpliceAI predicts no significant splice impact (max delta score = 0.06). REVEL and BayesDel are not applicable to deletions. No HCI prior score is available for CDKN2A. No computational evidence supports a damaging effect. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta = 0.06 (no predicted splice impact). REVEL/BayesDel not applicable to deletions. HCI prior not available for CDKN2A.
Sources
PP5 No reputable source definitively reports this variant as pathogenic. ClinVar aggregate classification is Uncertain Significance (13 submitters VUS, 1 submitter Likely Benign). No expert panel has reviewed this variant. The variant was classified as 'pathogenic' in the research context of PMID:25780468 based on study-specific criteria, but this does not constitute a clinical-grade reputable source report. Details ▾Hide ▴
Evidence considered
- ClinVar: 13 labs report VUS
- 1 lab (Ambry Genetics) reports Likely Benign. No expert panel classification. PMID:25780468 classified as pathogenic under research criteria but this is not a clinical diagnostic assertion.
Sources
BA1 The variant has a maximum allele frequency of 0.0136% in gnomAD v2.1 and 0.0095% in gnomAD v4.1, both well below the BA1 threshold of >1%. Details ▾Hide ▴
Evidence considered
- gnomAD v2.1 AF=0.0136%
- gnomAD v4.1 AF=0.0095%. Both well below BA1 >1% threshold.
Sources
BS1 The variant has a maximum allele frequency of 0.0136% in gnomAD v2.1 and 0.0095% in gnomAD v4.1, both below the BS1 threshold of >0.3%. The grpmax FAF in v4.1 is 0.071% (Admixed American), still below 0.3%. Details ▾Hide ▴
Evidence considered
- gnomAD v2.1 total AF=0.0136%
- grpmax FAF=0.034%
- gnomAD v4.1 total AF=0.0095%
- grpmax FAF=0.071%. All below BS1 >0.3% threshold.
Sources
BP6 Only one clinical laboratory (Ambry Genetics) classifies this variant as Likely Benign, while 13 other clinical laboratories report it as Uncertain Significance. The lack of consensus among reputable clinical sources does not meet the threshold for BP6, which requires a reputable source to report the variant as benign. Details ▾Hide ▴
Evidence considered
- ClinVar: 1 lab reports Likely Benign (Ambry Genetics)
- 13 labs report VUS. No consensus for benign classification.
Sources
Not assessed · 7 · no assessment recorded
PS2 No de novo evidence is available for this variant. None of the reviewed publications or ClinVar submissions reported a confirmed de novo occurrence. Details ▾Hide ▴
Still missing
- No de novo testing data available for this variant.
PM6 No confirmed de novo data available for this variant in any of the reviewed sources. Details ▾Hide ▴
Still missing
- No de novo testing data available.
PP1 No co-segregation data are available for this variant. While the variant was observed in melanoma families (PMID:10070944, PMID:16905682), formal segregation analysis was not reported. Details ▾Hide ▴
Still missing
- No formal co-segregation analysis available for the families in which this variant was identified.
PP4 No individual patient phenotype or clinical presentation data are available for this case. The variant has been observed in the context of melanoma family studies but no specific phenotype details for variant carriers are provided. Details ▾Hide ▴
Still missing
- No case-level phenotype data available.
BS4 No co-segregation data or family studies with non-segregation evidence are available for this variant. The variant has been observed in melanoma families but formal segregation analysis has not been performed. Details ▾Hide ▴
Still missing
- No co-segregation or non-segregation data available.
BP2 No data are available on whether this variant has been observed in trans with a known pathogenic CDKN2A variant. Details ▾Hide ▴
Still missing
- No trans configuration data available.
BP5 No data are available on whether this variant has been observed in a case with an alternative molecular basis for disease. Details ▾Hide ▴
Still missing
- No data on alternative molecular diagnoses in carriers.
Not applicable · 7· recorded as not applicable Show reasons ▾Hide reasons ▴
PVS1 N/AThis is an in-frame 24-bp deletion in exon 1 (p.Ala4_Pro11del) that does not fall into the default PVS1 null-variant buckets of nonsense, frameshift, or canonical ±1,2 splice consensus variants per the ClinGen SVI PVS1 framework (PMC6185798). PVS1 is not applicable to in-frame deletions of this class. Details ▾Hide ▴
Evidence considered
- In-frame deletion removing 8 N-terminal amino acids
- not a null variant by PVS1 decision algorithm.
Sources
pvs1_variant_assessmentpvs1_generic_framework
PS1 N/APS1 requires a nucleotide change at the same position as a known pathogenic missense variant. This variant is a 24-bp deletion, not a single-nucleotide substitution; PS1 does not apply to deletions. Details ▾Hide ▴
No further detail was recorded.
PM5 N/APM5 requires a different missense change at the same residue as a known pathogenic missense variant. This variant is a multi-residue deletion (codons 4-11); no same-residue missense comparator is definable. pm5_candidates.json confirms no eligible candidates could be harvested. Details ▾Hide ▴
Evidence considered
- PM5 not applicable to multi-residue deletions
- automated candidate harvesting returned no same-residue comparators.
Sources
pm5_candidates
PP2 N/APP2 applies to missense variants in genes with low rates of benign missense variation where missense is a common disease mechanism. This variant is an in-frame deletion, not a missense substitution. Details ▾Hide ▴
No further detail was recorded.
BP1 N/ABP1 applies to missense variants in genes where truncating variants are the primary disease mechanism. This variant is a deletion, not a missense substitution. Additionally, CDKN2A has both missense and truncating variants as established disease mechanisms for melanoma susceptibility. Details ▾Hide ▴
No further detail was recorded.
BP7 N/ABP7 applies to synonymous variants with no predicted splice impact. This variant is a 24-bp in-frame deletion, not a synonymous nucleotide substitution. Details ▾Hide ▴
No further detail was recorded.
PS5 N/APS5 applies to a different nucleotide change at the same codon as an established pathogenic missense variant. This variant is a 24-bp deletion spanning codons 4-11; PS5 semantics do not apply. Details ▾Hide ▴
No further detail was recorded.
Identifiers
- Gene
- CDKN2A
- Transcript
- NM_000077.4
- Coding (HGVS c.)
- NM_000077.4:c.9_32del
- Protein (HGVS p.)
- NP_000068.1:p.(Ala4_Pro11del)
- GRCh38
- chr9:21974795 AGGCTCCATGCTGCTCCCCGCCGCC>A
- GRCh37
- chr9:21974794 AGGCTCCATGCTGCTCCCCGCCGCC>A
- ClinVar
- 216277
- COSMIC
- COSV58687620
Gene diagram
Every interpreted variant in CDKN2A, mapped onto the exon structure of NM_000077.4. Select a row to find it on the plot.
CDKN2ANM_000077.4
Fetching transcript structure from UCSC…
Exons
—
Transcript span
—
Strand
—
Variants mapped
—
Source
UCSC ncbiRefSeqCurated
All variants in CDKN2A
—
Select a row to find it on the plot; use the link to open its page.
| Protein | Location | Classification | Link |
|---|
gnomAD v4.1
153 / 1,606,464 alleles
AF 9.52e-05 · 1 homozygotes · FAF 0.00071
gnomAD v2.1
36 / 265,240 alleles
AF 0.000136 · 0 homozygotes · FAF 0.000339
gnomAD-Canada v1.0
0 / 0 alleles
AF 0 · 0 homozygotes
By genetic ancestry
gnomAD v4.1
AF 9.5e-05 · 153 / 1,606,464 alleles · 1 hom · FAF 0.00071
| Admixed American54 / 59,888 | 0.00091 hom |
| Middle Eastern1 / 6,022 | 0.00017 |
| East Asian4 / 44,836 | 8.9e-05 |
| Remaining individuals5 / 62,342 | 8e-05 |
| European (non-Finnish)84 / 1,179,054 | 7.1e-05 |
| South Asian5 / 90,940 | 5.5e-05 |
0 alternate alleles recorded in 4 other groups: European (Finnish), Amish, Ashkenazi Jewish, African/African American.
gnomAD v2.1
AF 0.00014 · 36 / 265,240 alleles · 0 hom · FAF 0.00034
| Admixed American18 / 35,104 | 0.00051 |
| Remaining individuals2 / 6,928 | 0.00029 |
| East Asian2 / 19,354 | 0.0001 |
| European (non-Finnish)12 / 119,780 | 0.0001 |
| South Asian2 / 30,316 | 6.6e-05 |
0 alternate alleles recorded in 3 other groups: African/African American, Ashkenazi Jewish, European (Finnish).
gnomAD-Canada
AF 0 · 0 / 0 alleles · 0 hom
Statements
gnomAD v4.1
This variant is present in gnomAD v4.1 (AF= 9.52402e-05; MAF= 0.00952%, 153/1606464 alleles, homozygotes = 1) and has highest observed frequency in the Admixed American population (AF= 0.000901683; MAF= 0.09017%, 54/59888 alleles, homozygotes = 1); grpmax FAF= 0.00070967.
gnomAD v2.1
This variant is present in gnomAD v2.1 (AF= 0.000135726; MAF= 0.01357%, 36/265240 alleles, homozygotes = 0) and has highest observed frequency in the Admixed American population (AF= 0.000512762; MAF= 0.05128%, 18/35104 alleles, homozygotes = 0); grpmax FAF= 0.00033868.
gnomAD-Canada
Absent from gnomAD-Canada v1.0.
SpliceAI and Pangolin
Other predictors
- REVEL
- Not available
- BayesDel
- Not available
How the predictions were used
BP4 SupportingSpliceAI predicts no significant splice impact (max delta score = 0.06). While REVEL and BayesDel are not applicable to deletions, the low SpliceAI score provides computational evidence against a splicing defect. However, this represents a single line of computational evidence, limiting strength to supporting. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta score = 0.06
- indicating no predicted splice-altering effect.
Sources
PP3 In silico tools provide no evidence of pathogenicity. SpliceAI predicts no significant splice impact (max delta score = 0.06). REVEL and BayesDel are not applicable to deletions. No HCI prior score is available for CDKN2A. No computational evidence supports a damaging effect. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta = 0.06 (no predicted splice impact). REVEL/BayesDel not applicable to deletions. HCI prior not available for CDKN2A.
Sources
BP7 N/ABP7 applies to synonymous variants with no predicted splice impact. This variant is a 24-bp in-frame deletion, not a synonymous nucleotide substitution. Details ▾Hide ▴
No further detail was recorded.
Statement
In silico
In progress — evidence not uploaded yet.
8 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata. None of the listed paper records explicitly indicates that the variant is named.
Recorded publications
-
PMID 17047042 ↗High-risk melanoma susceptibility genes and pancreatic cancer, neural system tumors, and uveal melanoma across GenoMEL.Goldstein AM et al. · 2006No paper-specific finding is recorded.
-
PMID 25780468 ↗Prevalence and predictors of germline CDKN2A mutations for melanoma cases from Australia, Spain and the United Kingdom.No paper-specific finding is recorded.
-
PMID 28830827 ↗Germline Variation at CDKN2A and Associations with Nevus Phenotypes among Members of Melanoma Families.No paper-specific finding is recorded.
-
PMID 8668202 ↗Temperature-sensitive mutants of p16CDKN2 associated with familial melanoma.No paper-specific finding is recorded.
-
PMID 10070944 ↗CDKN2A variants in a population-based sample of Queensland families with melanoma.Aitken J et al. · 1999No paper-specific finding is recorded.
-
PMID 11159196 ↗CDKNA2A mutation analysis, protein expression, and deletion mapping of chromosome 9p in conventional clear-cell renal carcinomas: evidence for a second tumor suppressor gene proximal to CDKN2A.Schraml P et al. · 2001No paper-specific finding is recorded.
-
PMID 12072543 ↗Geographical variation in the penetrance of CDKN2A mutations for melanoma.Bishop DT et al. · 2002No paper-specific finding is recorded.
-
PMID 16905682 ↗Features associated with germline CDKN2A mutations: a GenoMEL study of melanoma-prone families from three continents.Goldstein AM et al. · 2007No paper-specific finding is recorded.
Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.
gnomAD v4.1
153 / 1,606,464 recorded alleles
Open source ↗
gnomAD v2.1
Captured gnomAD v2.1 source record
Open source ↗
SpliceAI Lookup
Recorded maximum delta 0.060
Open source ↗
ClinVar
13 Uncertain significance · 1 Likely benign
Open source ↗
COSMIC
Captured COSMIC source record
Open source ↗
Cancer hotspots
Captured Cancer Hotspots source record
Open source ↗
OncoKB
Captured OncoKB source record
Open source ↗
All source links
- ClinVar ↗www.ncbi.nlm.nih.gov/clinvar/variation/216277/
- gnomAD v2.1 ↗gnomad.broadinstitute.org/variant/9-21974794-AGGCTCCATGCTGCTCCC…
- gnomAD v4.1 ↗gnomad.broadinstitute.org/variant/chr9-21974795-AGGCTCCATGCTGCT…
- gnomAD-Canada ↗http://192.168.4.76:8001/variant/9-21974795-AGGCTCCATGCTGCTCCCC…
- SpliceAI Lookup ↗spliceailookup.broadinstitute.org/#variant=NM_000077.4%3Ac.9_32…
- OncoKB ↗www.oncokb.org/gene/CDKN2A/A4_P11del
- COSMIC ↗cancer.sanger.ac.uk/cosmic/mutation/overview?id=174985394
- Cancer hotspots ↗www.cancerhotspots.org/
Statements for reports
The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.
gnomAD v4.1
This variant is present in gnomAD v4.1 (AF= 9.52402e-05; MAF= 0.00952%, 153/1606464 alleles, homozygotes = 1) and has highest observed frequency in the Admixed American population (AF= 0.000901683; MAF= 0.09017%, 54/59888 alleles, homozygotes = 1); grpmax FAF= 0.00070967.
gnomAD v2.1
This variant is present in gnomAD v2.1 (AF= 0.000135726; MAF= 0.01357%, 36/265240 alleles, homozygotes = 0) and has highest observed frequency in the Admixed American population (AF= 0.000512762; MAF= 0.05128%, 18/35104 alleles, homozygotes = 0); grpmax FAF= 0.00033868.
gnomAD-Canada
Absent from gnomAD-Canada v1.0.
ClinVar
In progress — evidence not uploaded yet.
In silico
In progress — evidence not uploaded yet.
Functional
In progress — evidence not uploaded yet.
Somatic
In progress — evidence not uploaded yet.
Cancer Hotspots
This variant does not lie in a statistically significant hotspot.
Literature
In progress — evidence not uploaded yet.