CDKN2Ac.52_83delNot classified

Print report

Variant interpretation report

CDKN2A c.52_83del, p.(Thr18AlafsTer15)

NM_000077.4:c.52_83del NP_000068.1:p.(Thr18AlafsTer15) View identifiers

Classification

Not classified

Variant description:

No variant summary was recorded for this case.

Five-step scale from benign to pathogenic. Select a step to read what it means.

Not classified yet.Select a step to read what it means.

In plain language

Gene-level background from the recorded interpretation.

About CDKN2A

No gene-level summary was recorded for this case.

Key facts

Evidence used: 1 very strong (pathogenic) · 2 moderate (pathogenic)
Expert rules: Not recorded
Pipeline record: 29 Jul 2026 · version 7.0.4

Evidence considered

View criteria

Applied evidence criteria

PVS1 (very strong): NM_000077.4:c.52_83del is a 32 bp frameshift deletion in exon 1 predicted to produce a premature termination codon at position 32 (p.Thr18AlafsTer15), removing all four ankyrin-repeat domains and the CDK4/6 binding region of p16INK4A. Under PMC6185798, frameshift variants in genes with an established loss-of-function disease mechanism meet PVS1 at very strong strength. CDKN2A loss of function is a well-established germline disease mechanism for familial atypical multiple mole melanoma (FAMMM) and pancreatic ductal adenocarcinoma susceptibility. NMD is predicted as the premature termination codon resides >50 nucleotides upstream of the last exon–exon junction.
PM1 (moderate): NM_000077.4:c.52_83del creates a premature termination at codon 32, completely removing all four ankyrin-repeat domains (aa ~11-43, ~44-76, ~77-110, ~111-142) and the CDK4/6 binding region of p16INK4A, which are well-characterized functional domains critical for tumor suppressor activity. Under the PM1 domain-level rule, variants that remove or disrupt a critical functional domain characterized in the literature satisfy PM1.
PM2 (moderate): NM_000077.4:c.52_83del is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0 population databases. Under the non-VCEP generic ACMG framework, absence from population databases (allele frequency < 0.1%) satisfies PM2 at moderate strength.

LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.

01The reasoning

How it was classified

The recorded framework is Not recorded. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.

Recorded applied criteria

The applied criteria and their strengths are shown as assessed under the stated framework.

Pathogenic evidence criteria: 3 Benign evidence criteria: 0

Pathogenic criteria applied · 3

PVS1Very strong

PVS1 · very strong

NM_000077.4:c.52_83del is a 32 bp frameshift deletion in exon 1 predicted to produce a premature termination codon at position 32 (p.Thr18AlafsTer15), removing all four ankyrin-repeat domains and the CDK4/6 binding region of p16INK4A. Under PMC6185798, frameshift variants in genes with an established loss-of-function disease mechanism meet PVS1 at very strong strength. CDKN2A loss of function is a well-established germline disease mechanism for familial atypical multiple mole melanoma (FAMMM) and pancreatic ductal adenocarcinoma susceptibility. NMD is predicted as the premature termination codon resides >50 nucleotides upstream of the last exon–exon junction.

PM1Moderate

PM1 · moderate

NM_000077.4:c.52_83del creates a premature termination at codon 32, completely removing all four ankyrin-repeat domains (aa ~11-43, ~44-76, ~77-110, ~111-142) and the CDK4/6 binding region of p16INK4A, which are well-characterized functional domains critical for tumor suppressor activity. Under the PM1 domain-level rule, variants that remove or disrupt a critical functional domain characterized in the literature satisfy PM1.

PM2Moderate

PM2 · moderate

NM_000077.4:c.52_83del is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0 population databases. Under the non-VCEP generic ACMG framework, absence from population databases (allele frequency < 0.1%) satisfies PM2 at moderate strength.

Benign criteria applied · 0

No benign criterion marked as applied in the recorded assessment.

Recorded classification: Not classified

No source classification-combination explanation was recorded.

02The sources

Evidence at a glance

Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.

gnomAD v4.1

gnomAD v2.1

Population frequency

Not recorded

gnomAD v4.1 allele counts were not recorded for this variant.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

Applied · PM2 →

gnomAD v4.1 ↗gnomAD v2.1 ↗gnomAD-Canada ↗

SpliceAI score

0.010 maximum delta

Recorded SpliceAI maximum delta score: 0.010. Refer to the recorded PP3/BP4 rationale for interpretation.

No listed criterion applied SpliceAI ↗

ClinVar submissions

Not recorded

A ClinVar laboratory submission summary was not recorded. ClinVar API review status: criteria provided, single submitter.

Context only ClinVar ↗

Functional evidence

Statement recorded

In progress — evidence not uploaded yet.

No listed criterion applied OncoKB ↗

COSMIC

Cancer Hotspots

Somatic evidence

9 recorded samples

This variant has previously been reported in somatic cancers (COSMIC; COSV58693372, n = 9 times).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.

Context only

COSMIC ↗Cancer Hotspots ↗

For specialists

Technical detail

ACMG/AMP criteria under Not recorded, with the data and sources behind each one.

29 criteria with recorded statuses: 3 met · 17 not met · 0 not assessed · 9 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.

Pathogenic

PVS1 PS1 PS2 PS3 PS4 PM1 PM2 PM3 PM4 PM5 PM6 PP1 PP2 PP3 PP4 PP5 PS5

Benign

BA1 BS1 BS2 BS3 BS4 BP1 BP2 BP3 BP4 BP5 BP6 BP7

Met Not met Not assessed Not applicable

NM_000077.4:c.52_83del is a 32 bp frameshift deletion in exon 1 of CDKN2A predicted to produce a truncated protein (p.Thr18AlafsTer15) that removes all four ankyrin-repeat domains and the CDK4/6 binding region of p16INK4A, meeting PVS1 at very strong strength under the ClinGen SVI PVS1 framework (PMC6185798).

The variant is absent from gnomAD v2.1, v4.1, and Canada population databases, satisfying PM2 at moderate strength.

The variant completely removes the well-characterized ankyrin-repeat and CDK4/6 binding domains of p16INK4A, meeting PM1 at moderate strength. Published functional studies demonstrate that N-terminal deletions and premature termination mutants of p16INK4A abolish CDK4/6 binding and kinase inhibitory activity.

No functional study directly tested NM_000077.4:c.52_83del; PS3 is not met. Existing truncation data from PMID:8603820 (deletion constructs) and PMID:8668202 (premature termination mutants) provide domain-level evidence applied under PM1 rather than variant-specific PS3.

ClinVar classifies this variant as 'Likely oncogenic' (somatic, 1-star single submitter) under variation ID 4539651. This somatic classification and review status do not satisfy PP5 for germline pathogenicity assessment.

This variant has been reported in somatic cancers (COSMIC COSV58693372, n = 9) and is classified as Likely Oncogenic/Likely Loss-of-function by OncoKB, consistent with a deleterious biological effect.

Met · 3

PVS1 Very strongNM_000077.4:c.52_83del is a 32 bp frameshift deletion in exon 1 predicted to produce a premature termination codon at position 32 (p.Thr18AlafsTer15), removing all four ankyrin-repeat domains and the CDK4/6 binding region of p16INK4A. Under PMC6185798, frameshift variants in genes with an established loss-of-function disease mechanism meet PVS1 at very strong strength. CDKN2A loss of function is a well-established germline disease mechanism for familial atypical multiple mole melanoma (FAMMM) and pancreatic ductal adenocarcinoma susceptibility. NMD is predicted as the premature termination codon resides >50 nucleotides upstream of the last exon–exon junction. Details ▾Hide ▴

Evidence considered

Frameshift variant producing premature termination at codon 32 of 156 (NP_000068.1:p.(Thr18AlafsTer15))
CDKN2A loss-of-function mechanism supported by germline literature (PMC6185798 framework)
All four ankyrin-repeat domains and CDK4/6 binding region removed
NMD predicted: PTC at codon 32 is >50 nt upstream of last exon–exon junction

Sources

pvs1_generic_frameworkpvs1_gene_contextpvs1_variant_assessment

PM1 ModerateNM_000077.4:c.52_83del creates a premature termination at codon 32, completely removing all four ankyrin-repeat domains (aa ~11-43, ~44-76, ~77-110, ~111-142) and the CDK4/6 binding region of p16INK4A, which are well-characterized functional domains critical for tumor suppressor activity. Under the PM1 domain-level rule, variants that remove or disrupt a critical functional domain characterized in the literature satisfy PM1. Details ▾Hide ▴

Evidence considered

All four ankyrin repeats and CDK4/6 binding region removed by premature truncation at codon 32
PMID:8603820: the core region (aa 73-131) plus N-terminal sequences are essential for CDK4 inhibitory activity
constructs lacking the N-terminus (9-72
73-131
73-156) fail to inhibit CDK4
PMID:8668202: seven of eight premature termination mutants (including R58ter
the earliest truncation tested) lose CDK4/6 binding

Sources

PMID:8603820 ↗PMID:8668202 ↗

PM2 ModerateNM_000077.4:c.52_83del is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0 population databases. Under the non-VCEP generic ACMG framework, absence from population databases (allele frequency < 0.1%) satisfies PM2 at moderate strength. Details ▾Hide ▴

Evidence considered

Absent from gnomAD v2.1 (exomes)
Absent from gnomAD v4.1 (exomes)
Absent from gnomAD-Canada v1.0 (genomes)

Sources

gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗

Not met · 17 · evaluated, threshold not reached

PS2 No de novo observation of NM_000077.4:c.52_83del has been reported in any reviewed publication or database. Details ▾Hide ▴

Still missing

No de novo data available for this variant

PS3 No functional study directly tested NM_000077.4:c.52_83del. Published functional data on other CDKN2A truncation variants (PMID:8668202, PMID:8603820) demonstrates that N-terminal premature termination mutants abolish CDK4/6 binding and kinase inhibitory activity; however, this constitutes domain-level evidence appropriate for PM1 rather than variant-specific PS3. A missense variant at the same codon (p.Thr18Pro) was tested in PMID:35001868 and found functionally deleterious in a cell proliferation assay, but this is a different variant type and does not meet the threshold for PS3. Under the PS3 calibration rules, domain-level inference from sparse residue testing does not qualify for any PS3 strength. Details ▾Hide ▴

Evidence considered

PMID:8668202: premature termination mutants (R58ter
R80ter
W110ter
E120ter
etc.) lose CDK4/6 binding — domain-level evidence only
PMID:8603820: N-terminal deletion construct (aa 9-72) abolishes inhibitory function — domain-level evidence only
PMID:35001868: p.Thr18Pro (missense
same codon) is functionally deleterious — nearby residue
different variant type

Still missing

No direct functional testing of NM_000077.4:c.52_83del

PS4 No case-control data comparing the prevalence of NM_000077.4:c.52_83del in affected individuals versus controls has been reported. The ClinVar entry (4539651) is a somatic 'Likely oncogenic' classification without germline case observations. Details ▾Hide ▴

Still missing

No case-control or cohort prevalence data available

PM6 No de novo observation of NM_000077.4:c.52_83del has been reported. PM6 requires a specific de novo report for this exact variant, which was not found in any reviewed publication or database. Details ▾Hide ▴

Still missing

No de novo data available

PP1 No cosegregation data are available for NM_000077.4:c.52_83del. No family studies reporting segregation of this variant with disease were identified in the reviewed literature. Details ▾Hide ▴

Still missing

No family segregation data available

PP3 In silico prediction tools applicable to this variant type do not provide evidence of deleterious effect. SpliceAI predicts no significant splice impact (max delta score = 0.01). REVEL and BayesDel are not applicable to non-SNV variants. HCI prior scores are not available for CDKN2A. The deleterious effect of this frameshift variant is inherent in its molecular consequence (protein truncation) rather than captured by in silico predictors. Details ▾Hide ▴

Evidence considered

SpliceAI max delta score = 0.01 (no predicted splice impact)
REVEL not applicable (non-SNV)
BayesDel not applicable (non-SNV)
HCI prior not available for CDKN2A

Still missing

No in silico tools designed to predict pathogenicity of frameshift variants

Sources

spliceai ↗

PP4 No patient phenotype or clinical data are available for NM_000077.4:c.52_83del. PP4 requires that the patient's phenotype or family history is highly specific for a disease with a single genetic etiology, which cannot be assessed without clinical information. Details ▾Hide ▴

Still missing

No patient phenotype data available

PP5 ClinVar variation ID 4539651 classifies this variant as 'Likely oncogenic' with a review status of 'criteria provided, single submitter' (1-star). This is a somatic oncogenicity classification, not a germline pathogenicity assertion. Under the PP5/BP6 rule requiring ClinVar 3-star expert panel designation at supporting strength, a 1-star somatic classification does not satisfy PP5. None of the reviewed publications report this specific variant as pathogenic in a germline context. Details ▾Hide ▴

Evidence considered

ClinVar ID 4539651: 'Likely oncogenic' (somatic)
1-star review status (criteria provided
single submitter)

Still missing

No ClinVar 3-star expert panel germline classification available

Sources

clinvar ↗

BA1 NM_000077.4:c.52_83del is absent from gnomAD v2.1, v4.1, and Canada population databases. BA1 requires an allele frequency >1% in any population, which is not met. Details ▾Hide ▴

Evidence considered

Absent from all gnomAD population databases (frequency = 0%)

Sources

gnomad_v2 ↗gnomad_v4 ↗

BS1 NM_000077.4:c.52_83del is absent from gnomAD population databases. Under the non-VCEP generic framework, BS1 requires an allele frequency >0.3%, which is not met. Details ▾Hide ▴

Evidence considered

Absent from all gnomAD population databases (frequency = 0%)

Sources

gnomad_v2 ↗gnomad_v4 ↗

BS2 No data are available regarding observation of NM_000077.4:c.52_83del in healthy adult individuals. The variant is absent from population databases, and no publication reports it in a healthy control cohort. Details ▾Hide ▴

Still missing

No data on observation in healthy controls

BS3 No functional study demonstrates that NM_000077.4:c.52_83del has no deleterious effect. Published functional data on CDKN2A truncating variants consistently shows loss of function (PMID:8603820, PMID:8668202), which contradicts a benign functional interpretation. Details ▾Hide ▴

Evidence considered

PMID:8668202: N-terminal premature termination mutants lose CDK4/6 binding and kinase inhibitory activity
PMID:8603820: N-terminal deletion (aa 9-72) abolishes CDK4 inhibitory function

BS4 No nonsegregation data are available for NM_000077.4:c.52_83del. BS4 requires observation that the variant does not segregate with disease in affected family members, which cannot be assessed without family data. Details ▾Hide ▴

Still missing

No family segregation data available

BP2 No data are available regarding the observation of NM_000077.4:c.52_83del in trans with a known pathogenic CDKN2A variant. BP2 requires specific phase information, which cannot be assessed without additional genotyping data. Details ▾Hide ▴

Still missing

No phasing data available

BP4 BP4 requires multiple lines of computational evidence suggesting no impact on the gene or gene product. SpliceAI predicts no significant splicing impact (max delta = 0.01), but the variant creates a frameshift with premature termination at codon 32, which has a clear and severe impact on the protein product regardless of splicing effects. BP4 is not satisfied because the molecular consequence of the variant is unambiguously deleterious. Details ▾Hide ▴

Evidence considered

SpliceAI max delta score = 0.01 (no predicted splice impact)
Frameshift with premature termination creates unequivocal protein-level impact

Sources

spliceai ↗

BP5 No data are available indicating that NM_000077.4:c.52_83del is found in a case with an alternative molecular basis for disease. BP5 requires observation of the variant in an affected individual with a clear alternative etiologic cause. Details ▾Hide ▴

Still missing

No data on alternative molecular etiology in carriers

BP6 ClinVar classifies NM_000077.4:c.52_83del as 'Likely oncogenic' (somatic), not as 'Benign' or 'Likely Benign.' BP6 requires a reputable source to report the variant as benign, which is not the case. Details ▾Hide ▴

Evidence considered

ClinVar ID 4539651: classified as 'Likely oncogenic' (somatic)
not benign

Sources

clinvar ↗

Not applicable · 9· recorded as not applicable Show reasons ▾Hide reasons ▴

PS1 N/APS1 applies to a nucleotide change producing the same amino acid change as an established pathogenic variant. This variant is a 32 bp deletion causing a frameshift, not a single nucleotide substitution. Details ▾Hide ▴

No further detail was recorded.

PM3 N/ASkipped per adjudication directive — PM3 was explicitly excluded from assessment for this case. Details ▾Hide ▴

No further detail was recorded.

PM4 N/APM4 applies to in-frame deletions/insertions in a nonrepeat region or stop-loss variants. NM_000077.4:c.52_83del is a 32 bp out-of-frame deletion causing a frameshift and premature termination, not an in-frame change. Details ▾Hide ▴

No further detail was recorded.

PM5 N/APM5 applies to a novel missense change at the same amino acid residue as a known pathogenic missense variant. NM_000077.4:c.52_83del is a 32 bp deletion causing a frameshift, not a missense variant. PM5 candidate harvesting confirmed no classic same-residue missense comparators are applicable. Details ▾Hide ▴

No further detail was recorded.

PP2 N/APP2 applies specifically to missense variants in genes with a low rate of benign missense variation. NM_000077.4:c.52_83del is a frameshift deletion, not a missense variant. Details ▾Hide ▴

No further detail was recorded.

BP1 N/ABP1 applies to missense variants in genes where truncating variants are the primary disease mechanism. NM_000077.4:c.52_83del is itself a truncating (frameshift) variant, not a missense variant. Details ▾Hide ▴

No further detail was recorded.

BP3 N/ABP3 applies to in-frame deletions or insertions in repetitive regions without a known function. NM_000077.4:c.52_83del is an out-of-frame deletion causing a frameshift, not an in-frame variant in a repetitive region. Details ▾Hide ▴

No further detail was recorded.

BP7 N/ABP7 applies to synonymous variants for which splicing prediction algorithms predict no impact. NM_000077.4:c.52_83del is a 32 bp deletion causing a frameshift, not a synonymous variant. Details ▾Hide ▴

No further detail was recorded.

PS5 N/APS5 is not a criterion in the standard ACMG/AMP 2015 classification framework used for this assessment (generic_acmg fallback). No VCEP/CSPEC framework defines PS5 for CDKN2A. Details ▾Hide ▴

No further detail was recorded.

Identifiers

Gene: CDKN2A
Transcript: NM_000077.4
Coding (HGVS c.): NM_000077.4:c.52_83del
Protein (HGVS p.): NP_000068.1:p.(Thr18AlafsTer15)
GRCh38: chr9:21974744 CACCTCCTCTACCCGACCCCGGGCCGCGGCCGT>C
GRCh37: chr9:21974743 CACCTCCTCTACCCGACCCCGGGCCGCGGCCGT>C
ClinVar: 4539651
COSMIC: COSV58693372

Gene diagram

Every interpreted variant in CDKN2A, mapped onto the exon structure of NM_000077.4. Select a row to find it on the plot.

CDKN2ANM_000077.4

Fetching transcript structure from UCSC…

Exons

—

Transcript span

—

Strand

—

Variants mapped

—

Source

UCSC ncbiRefSeqCurated

All variants in CDKN2A — Select a row to find it on the plot; use the link to open its page.

	Protein	Location	Classification	Link

gnomAD v4.1 Allele count data not recorded

gnomAD v2.1 Allele count data not recorded

gnomAD-Canada v1.0 0 / 0 alleles AF 0 · 0 homozygotes

By genetic ancestry

gnomAD-Canada

AF 0 · 0 / 0 alleles · 0 hom

Statements

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

Open the gnomAD-Canada detail page →

SpliceAI and Pangolin

SpliceAI acceptor lossat +206 bp

0.000

SpliceAI acceptor gainat -307 bp

0.010

SpliceAI donor lossat +348 bp

0.000

SpliceAI donor gainat -49 bp

0.000

Pangolin splice lossmagnitude shown

-0.080

Pangolin splice gain

0.010

Other predictors

REVEL: Not available
BayesDel: Not available

How the predictions were used

Evidence considered

SpliceAI max delta score = 0.01 (no predicted splice impact)
REVEL not applicable (non-SNV)
BayesDel not applicable (non-SNV)
HCI prior not available for CDKN2A

Still missing

No in silico tools designed to predict pathogenicity of frameshift variants

Sources

spliceai ↗

Evidence considered

SpliceAI max delta score = 0.01 (no predicted splice impact)
Frameshift with premature termination creates unequivocal protein-level impact

Sources

spliceai ↗

No further detail was recorded.

Statement

In silico

In progress — evidence not uploaded yet.

7 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata. None of the listed paper records explicitly indicates that the variant is named.

Recorded publications

Cancer-associated mis-sense and deletion mutations impair p16INK4 CDK inhibitory activity.

No paper-specific finding is recorded.

PMID 8603820 ↗
Temperature-sensitive mutants of p16CDKN2 associated with familial melanoma.

No paper-specific finding is recorded.

PMID 8668202 ↗
Systematic Functional Annotation of Somatic Mutations in Cancer.

Ng PK et al. · 2018

No paper-specific finding is recorded.

PMID 29533785 ↗
Functional CDKN2A assay identifies frequent deleterious alleles misclassified as variants of uncertain significance.

Kimura H et al. · 2022

No paper-specific finding is recorded.

PMID 35001868 ↗
Opportunities and challenges associated with clinical diagnostic genome sequencing: a report of the Association for Molecular Pathology.

Schrijver I et al. · 2012

No paper-specific finding is recorded.

PMID 22918138 ↗
Chromosomal microarray analysis, including constitutional and neoplastic disease applications, 2021 revision: a technical standard of the American College of Medical Genetics and Genomics (ACMG).

Shao L et al. · 2021

No paper-specific finding is recorded.

PMID 34131312 ↗
American College of Medical Genetics and Genomics technical standards and guidelines: microarray analysis for chromosome abnormalities in neoplastic disorders.

Cooley LD et al. · 2013

No paper-specific finding is recorded.

PMID 23619274 ↗

Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.

gnomAD v4.1 Captured gnomAD v4.1 source record Open source ↗

gnomAD v2.1 Captured gnomAD v2.1 source record Open source ↗

SpliceAI Lookup Recorded maximum delta 0.010 Open source ↗

ClinVar Captured ClinVar source record Open source ↗

COSMIC Captured COSMIC source record Open source ↗

Cancer hotspots Captured Cancer Hotspots source record Open source ↗

OncoKB Captured OncoKB source record Open source ↗

All source links

Statements for reports

The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

ClinVar

In progress — evidence not uploaded yet.

In silico

In progress — evidence not uploaded yet.

Functional

In progress — evidence not uploaded yet.

Somatic

In progress — evidence not uploaded yet.

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.

Literature

In progress — evidence not uploaded yet.