About KIT
No gene-level summary was recorded for this case.
Previous versions
Variant interpretation report
KIT c.1679_1738delinsATG, p.(Val560_His580delinsAspAsp)
Classification
Uncertain significance
Variant description:
No variant summary was recorded for this case.
Five-step scale from benign to pathogenic. This variant is uncertain. Select a step to read what it means.
Uncertain.The recorded classification is uncertain significance.
In plain language
Gene-level background from the recorded interpretation.
Words with a dotted underline have a short definition. Hover or tap them.
LYFE Sciences is an AI system, and it can make mistakes.
Criteria may be applied incorrectly, sources may be misread, and a
confident-looking classification can still be wrong.
Double-check every criterion and its underlying evidence
before relying on any call.
01The reasoning
How it was classified
The recorded framework is Not recorded. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.
Recorded applied criteria
The applied criteria and their strengths are shown as assessed under the stated framework.
Pathogenic evidence criteria: 3
Benign evidence criteria: 0
Pathogenic criteria applied · 3
PM1Moderate
PM1 · moderate
This variant removes amino acids 560-580 of the KIT juxtamembrane domain (exon 11), a well-characterized critical autoinhibitory domain. The juxtamembrane domain functions to inhibit receptor dimerization in the absence of ligand; in-frame deletions within this domain disrupt autoinhibition, causing ligand-independent constitutive kinase activation. Located in a statistically significant cancer hotspot (cancerhotspots.org).
PM2Supporting
PM2 · supporting
This variant is absent from gnomAD v2.1 (exomes) and gnomAD v4.1 (exomes/genomes), indicating it is extremely rare or absent in the general population (allele frequency <0.1% threshold for PM2).
PM4Supporting
PM4 · supporting
This in-frame deletion-insertion removes 21 amino acids (Val560 through His580) and replaces them with 2 amino acids (Asp-Asp), representing a net loss of 19 amino acids in a non-repeat region. The protein length change occurs within the functionally critical KIT juxtamembrane autoinhibitory domain.
Benign criteria applied · 0
No benign criterion marked as applied in the recorded assessment.
Recorded classification: Uncertain significance
gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PM1 moderate, PM2 supporting, PM4 supporting; combination = 1 moderate + 2 supporting, which maps to VUS.
02The sources
Evidence at a glance
Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.
gnomAD v4.1
gnomAD v2.1
Population frequency
Not recorded
gnomAD v4.1 allele counts were not recorded for this variant.
gnomAD v2.1
Absent from gnomAD v2.1.
gnomAD-Canada
Absent from gnomAD-Canada v1.0.
SpliceAI score
0.010 maximum delta
Recorded SpliceAI maximum delta score: 0.010. Refer to the recorded PP3/BP4 rationale for interpretation.
No listed criterion applied
SpliceAI ↗
ClinVar submissions
Not recorded
A ClinVar laboratory submission summary was not recorded.
Context only
ClinVar ↗
Functional evidence
Statement recorded
OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Gain-of-function; curated oncogenicity label: Likely Oncogenic.
No listed criterion applied
OncoKB ↗
COSMIC
Cancer Hotspots
Somatic evidence
No matching record reported
This variant has not previously been reported in somatic cancers (COSMIC).
Cancer Hotspots
This variant lies in a statistically significant hotspot.
Context only
For specialists
Technical detail
ACMG/AMP criteria under Not recorded, with the data and sources behind each one.
28 criteria with recorded statuses: 3 met · 19 not met · 0 not assessed · 6 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.
Met
Not met
Not assessed
Not applicable
NM_000222.2:c.1679_1738delinsATG is an in-frame deletion-insertion in KIT exon 11 resulting in p.Val560_His580delinsAspAsp, which removes a 21-amino-acid segment of the juxtamembrane autoinhibitory domain. PM1 (moderate) is met: the juxtamembrane domain is a well-characterized critical functional domain, and its disruption causes ligand-independent constitutive kinase activation.
PM2 (supporting) is met: the variant is absent from gnomAD v2.1 and v4.1 population databases.
PM4 (supporting) is met: a non-repeat in-frame deletion of 21 amino acids in a functionally critical domain.
PVS1 is not applicable: this is an in-frame deletion-insertion, not a null variant eligible under ClinGen PVS1 decision tree criteria (PMC6185798).
PS3 is not met: no variant-specific functional study directly testing p.Val560_His580delinsAspAsp was found in the provided literature. The gain-of-function mechanism of KIT exon 11 deletions is well-established at the domain level and contributes to PM1, but does not independently satisfy PS3 variant-specific functional evidence requirements.
PS1, PS5, and PM5 are not applicable to this indel variant type.
No benign criteria are met. BS3 is specifically not met because functional evidence supports a gain-of-function pathogenic mechanism.
Total evidence: PM1 (moderate) + PM2 (supporting) + PM4 (supporting). This combination is consistent with a classification of Likely Pathogenic under ACMG/AMP 2015 combination rules (2 moderate + supporting evidence).
No criteria match.
Met · 3
PM1 ModerateThis variant removes amino acids 560-580 of the KIT juxtamembrane domain (exon 11), a well-characterized critical autoinhibitory domain. The juxtamembrane domain functions to inhibit receptor dimerization in the absence of ligand; in-frame deletions within this domain disrupt autoinhibition, causing ligand-independent constitutive kinase activation. Located in a statistically significant cancer hotspot (cancerhotspots.org). Details ▾Hide ▴
Evidence considered
- Cancerhotspots.org identifies this region as a statistically significant hotspot. PMID:15365079 (Corless et al.
- J Clin Oncol 2004) describes the KIT exon 11 juxtamembrane domain as a critical autoinhibitory region
- in-frame deletions disrupt this function
- allowing ligand-independent receptor dimerization and constitutive kinase activation. The deletion of 21 amino acids (560-580) removes a substantial portion of this functionally characterized domain.
Sources
PM2 SupportingThis variant is absent from gnomAD v2.1 (exomes) and gnomAD v4.1 (exomes/genomes), indicating it is extremely rare or absent in the general population (allele frequency <0.1% threshold for PM2). Details ▾Hide ▴
Evidence considered
- Absent from gnomAD v2.1. Absent from gnomAD v4.1. Absent from gnomAD-Canada v1.0.
Sources
PM4 SupportingThis in-frame deletion-insertion removes 21 amino acids (Val560 through His580) and replaces them with 2 amino acids (Asp-Asp), representing a net loss of 19 amino acids in a non-repeat region. The protein length change occurs within the functionally critical KIT juxtamembrane autoinhibitory domain. Details ▾Hide ▴
Evidence considered
- In-frame deletion of 21 amino acids in the KIT juxtamembrane domain
- a non-repeat
- functionally critical region. PMID:15365079 confirms that in-frame deletions in this domain disrupt autoinhibitory function and cause constitutive kinase activation.
Sources
Not met · 19 · evaluated, threshold not reached
PS2 No de novo observation was identified for NM_000222.2:c.1679_1738delinsATG in any of the reviewed literature or database evidence. Details ▾Hide ▴
Evidence considered
- No de novo data available in ClinVar
- literature packet
- or evidence brief.
Still missing
- No parental testing data available.
PS3 No variant-specific functional study directly testing NM_000222.2:c.1679_1738delinsATG (p.Val560_His580delinsAspAsp) was identified in the provided literature. The reviewed papers describe KIT exon 11 in-frame deletions as a class with gain-of-function mechanism via juxtamembrane autoinhibition disruption, but this is domain-level characterization (PM1 territory), not variant-specific or systematic-range functional data meeting PS3 requirements. OncoKB curation classifies this variant as Likely Oncogenic/Likely Gain-of-function, but the primary functional data supporting this annotation was not available for review. Details ▾Hide ▴
Evidence considered
- OncoKB classified this variant as Likely Oncogenic with Likely Gain-of-function
- but this is a curated literature gateway
- not primary functional data. PMID:15365079 describes the general mechanism of KIT exon 11 in-frame deletions as activating (gain-of-function via juxtamembrane domain disruption)
- but does not test the specific V560_H580delinsDD variant. PMID:17372901 tested L576P
- a different exon 11 point mutation
- not this deletion.
Still missing
- Primary functional data directly testing p.Val560_His580delinsAspAsp was not available in the case folder. OncoKB cites curated literature behind its Likely Oncogenic designation but the underlying PMIDs (12181401
- 15365079
- 15451219
- 16098458
- 17372901) do not test this specific variant. The clinical significance of this well-known GIST-associated exon 11 deletion warrants review of primary functional studies in the broader literature.
Sources
PS4 This variant is absent from ClinVar and no case-control prevalence data in affected individuals versus controls was identified. Details ▾Hide ▴
Evidence considered
- Variant absent from ClinVar
- no affected vs. control prevalence data available.
Still missing
- No case observations in the provided evidence base.
Sources
PM6 No de novo observation was identified for this variant in any of the reviewed literature. Details ▾Hide ▴
Evidence considered
- No de novo data available.
Still missing
- No parental testing or de novo confirmation data available.
PP1 No segregation data is available for this variant. No family studies were identified in the reviewed literature. Details ▾Hide ▴
Evidence considered
- No co-segregation data available.
Still missing
- No segregation or family data available.
PP2 PP2 applies to genes where missense variants are a common mechanism of disease and the variant is a missense change. This is an in-frame indel in KIT, a gene where gain-of-function (not loss-of-function) is the primary disease mechanism, and the gene is not established as one where missense variants are a predominant pathogenic mechanism in a PP2-compatible framework. Details ▾Hide ▴
Evidence considered
- PP2 criteria are not met for an in-frame indel in a gain-of-function oncogene.
PP3 In silico predictors (REVEL, BayesDel) are not available for this indel variant. SpliceAI predicts no significant splice impact (max delta score = 0.01), which does not support a deleterious splicing effect. HCI prior score is not available for this gene. No computational evidence supports a deleterious effect. Details ▾Hide ▴
Evidence considered
- REVEL/BayesDel not applicable to indels. SpliceAI max delta score = 0.01 (no predicted splicing impact). HCI prior not available.
Still missing
- No in silico predictors available for in-frame indels.
Sources
PP4 No specific phenotype data was identified for this variant. The variant is absent from ClinVar, and no case reports describing the phenotype of individuals harboring this specific variant were found in the reviewed literature. Details ▾Hide ▴
Evidence considered
- No phenotype data for this variant available.
Still missing
- No case-level phenotype information available.
BA1 This variant is absent from gnomAD v2.1 and v4.1. Allele frequency of 0 is well below the BA1 threshold (>1%). Details ▾Hide ▴
Evidence considered
- Absent from gnomAD (AF = 0)
- far below BA1 threshold of >1%.
Sources
BS1 This variant is absent from gnomAD v2.1 and v4.1. Allele frequency of 0 is below the BS1 threshold (>0.3%). Details ▾Hide ▴
Evidence considered
- Absent from gnomAD (AF = 0)
- below BS1 threshold of >0.3%.
Sources
BS2 No evidence of observation in healthy adult individuals was identified for this variant. Details ▾Hide ▴
Evidence considered
- No observed occurrences in healthy controls.
Still missing
- No control cohort data available.
BS3 Well-established functional studies show KIT exon 11 in-frame deletions are gain-of-function (activating) mutations that disrupt juxtamembrane autoinhibition and cause constitutive kinase activation. This evidence supports pathogenicity, not a benign interpretation. Details ▾Hide ▴
Evidence considered
- PMID:15365079 describes KIT exon 11 in-frame deletions as gain-of-function mutations causing ligand-independent kinase activation. OncoKB classifies this variant as Likely Oncogenic/Likely Gain-of-function. Functional evidence supports a pathogenic mechanism.
Sources
BS4 No segregation data suggesting lack of segregation with disease was identified. Details ▾Hide ▴
Evidence considered
- No segregation data available.
Still missing
- No family/segregation data available.
BP1 BP1 applies to missense variants in genes where truncating variants are the primary mechanism of disease. This is an in-frame deletion-insertion, not a missense variant, and KIT disease mechanism is gain-of-function, not loss-of-function via truncation. Details ▾Hide ▴
Evidence considered
- BP1 is applicable only to missense variants in genes with a truncating disease mechanism. This is an in-frame indel in a gain-of-function oncogene.
BP2 No observation of this variant in trans with a known pathogenic variant was identified. Details ▾Hide ▴
Evidence considered
- No in-trans observations available.
Still missing
- No phase data available.
BP3 BP3 applies to silent and intronic variants without predicted splicing impact. This is an in-frame deletion-insertion in the coding region of a critical functional domain. Details ▾Hide ▴
Evidence considered
- This is a coding in-frame deletion-insertion in a known functional domain
- BP3 does not apply.
BP4 While SpliceAI predicts no splicing impact (max delta = 0.01), this is an in-frame deletion with well-established functional consequences via disruption of the juxtamembrane autoinhibitory domain. The absence of splicing impact does not support a benign interpretation for a variant with a known gain-of-function mechanism at the protein level. REVEL and BayesDel are not available for indels. Details ▾Hide ▴
Evidence considered
- SpliceAI predicts no splicing impact (max delta = 0.01)
- but this does not constitute benign evidence for a coding in-frame deletion with known gain-of-function consequences.
Sources
BP5 No evidence was identified that this variant is found in a case with an alternative molecular basis for disease. Details ▾Hide ▴
Evidence considered
- No alternative molecular basis data available.
Still missing
- No case-level data to evaluate alternative diagnoses.
BP7 BP7 applies to synonymous (silent) variants with no predicted splicing impact. This is an in-frame deletion-insertion, not a synonymous variant. SpliceAI predicts no splicing impact (max delta = 0.01), but BP7 criteria are restricted to silent variants. Details ▾Hide ▴
Evidence considered
- In-frame deletion-insertion is not a silent variant. BP7 criteria are not met regardless of splice prediction.
Sources
Not applicable · 6· recorded as not applicable Show reasons ▾Hide reasons ▴
PVS1 N/AIn-frame deletion-insertion (NP_000213.1:p.Val560_His580delinsAspAsp) is not a null variant. The ClinGen SVI PVS1 decision tree (PMC6185798) excludes this variant from the default null-variant buckets (nonsense, frameshift, or canonical ±1,2 splice consensus). PVS1 is not applicable to in-frame deletions. Details ▾Hide ▴
Evidence considered
- Variant bucket classified as 'other' by PVS1 variant assessment
- in-frame deletion-insertion does not qualify for PVS1 under ClinGen PVS1 recommendations.
Sources
PS1 N/APS1 requires a different amino acid change at the same residue as a known pathogenic missense variant. This variant is an in-frame deletion-insertion, not a missense change, and PS1 semantics cannot be applied to indels. Details ▾Hide ▴
Evidence considered
- In-frame deletion-insertion variant type incompatible with PS1 same-residue missense comparison.
PM5 N/AThis is an in-frame deletion-insertion, not a missense variant. Classic PM5 requires a different missense change at the same residue as a known pathogenic missense variant. PM5 candidate harvesting was unable to resolve classic same-residue semantics for this variant type. Details ▾Hide ▴
Evidence considered
- PM5 candidate harvesting unable to confirm classic same-residue semantics
- variant is an indel
- not a missense change.
Sources
pm5_candidates
PP5 N/AThis variant is absent from ClinVar. No reputable source (≥3-star expert panel) classifies this variant as pathogenic. Details ▾Hide ▴
Evidence considered
- Variant absent from ClinVar
- no reputable source classification available.
Sources
BP6 N/AThis variant is absent from ClinVar. No reputable source classifies it as benign. Details ▾Hide ▴
Evidence considered
- Variant absent from ClinVar. BP6 requires a reputable source classifying the variant as benign.
Sources
PS5 N/APS5 requires a different amino acid change at the same residue as a known pathogenic missense variant. This is an indel, not a missense change, and PS5 semantics cannot be applied. Details ▾Hide ▴
Evidence considered
- In-frame deletion-insertion variant type incompatible with PS5 same-residue comparison.
Identifiers
- Gene
- KIT
- Transcript
- NM_000222.2
- Coding (HGVS c.)
- NM_000222.2:c.1679_1738delinsATG
- Protein (HGVS p.)
- NP_000213.1:p.(Val560_His580delinsAspAsp)
- GRCh38
- chr4:54727447 TTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGATC>ATG
- GRCh37
- chr4:55593613 TTGAGGAGATAAATGGAAACAATTATGTTTACATAGACCCAACACAACTTCCTTATGATC>ATG
Gene diagram
Every interpreted variant in KIT, mapped onto the exon structure of NM_000222.2. Select a row to find it on the plot.
KITNM_000222.2
Fetching transcript structure from UCSC…
Exons
—
Transcript span
—
Strand
—
Variants mapped
—
Source
UCSC ncbiRefSeqCurated
All variants in KIT
—
Select a row to find it on the plot; use the link to open its page.
| Protein | Location | Classification | Link |
|---|
gnomAD v4.1
Allele count data not recorded
gnomAD v2.1
Allele count data not recorded
gnomAD-Canada v1.0
Allele count data not recorded
Statements
gnomAD v4.1
Absent from gnomAD v4.1.
gnomAD v2.1
Absent from gnomAD v2.1.
gnomAD-Canada
Absent from gnomAD-Canada v1.0.
SpliceAI and Pangolin
Other predictors
- REVEL
- Not available
- BayesDel
- Not available
How the predictions were used
PP3 In silico predictors (REVEL, BayesDel) are not available for this indel variant. SpliceAI predicts no significant splice impact (max delta score = 0.01), which does not support a deleterious splicing effect. HCI prior score is not available for this gene. No computational evidence supports a deleterious effect. Details ▾Hide ▴
Evidence considered
- REVEL/BayesDel not applicable to indels. SpliceAI max delta score = 0.01 (no predicted splicing impact). HCI prior not available.
Still missing
- No in silico predictors available for in-frame indels.
Sources
BP4 While SpliceAI predicts no splicing impact (max delta = 0.01), this is an in-frame deletion with well-established functional consequences via disruption of the juxtamembrane autoinhibitory domain. The absence of splicing impact does not support a benign interpretation for a variant with a known gain-of-function mechanism at the protein level. REVEL and BayesDel are not available for indels. Details ▾Hide ▴
Evidence considered
- SpliceAI predicts no splicing impact (max delta = 0.01)
- but this does not constitute benign evidence for a coding in-frame deletion with known gain-of-function consequences.
Sources
BP7 BP7 applies to synonymous (silent) variants with no predicted splicing impact. This is an in-frame deletion-insertion, not a synonymous variant. SpliceAI predicts no splicing impact (max delta = 0.01), but BP7 criteria are restricted to silent variants. Details ▾Hide ▴
Evidence considered
- In-frame deletion-insertion is not a silent variant. BP7 criteria are not met regardless of splice prediction.
Sources
Statement
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.01).
5 paper records listed. 1 cited in the classification. None of the listed paper records explicitly indicates that the variant is named.
Cited in the classification
-
PMID 15365079 ↗Biology of gastrointestinal stromal tumors.Comprehensive review of GIST biology describing KIT exon 11 juxtamembrane domain as a critical autoinhibitory region. Reports that in-frame deletions within exon 11 disrupt autoinhibition, allowing ligand-independent receptor dimerization and constitutive kinase activation. Notes that deletions tend to affect codons 557-559, and that the wild-type juxtamembrane peptide is inhibitory to activated KIT isoforms. The specific p.Val560_His580delinsAspAsp variant is not individually reported or tested.→ PM1 → PM4 Does not name this variant
Source detail
The juxtamembrane region of KIT (exon 11) functions to inhibit receptor dimerization in the absence of SCF. Mutagenesis studies of KIT have demonstrated that small in-frame deletions and insertions or point mutations of this domain disrupt this function, allowing ligand-independent receptor dimerization.
Location Mutations of the Juxtamembrane Domain (exon 11) section, pages 3816-3817
Context Review article; cites primary mutagenesis studies (Hirota et al 1998, Ma et al 2002, Chan et al 2003) demonstrating constitutive kinase activation of KIT exon 11 in-frame deletion mutants in Ba/F3 transformation assays.
Other recorded publications
-
PMID 12181401 ↗Efficacy and safety of imatinib mesylate in advanced gastrointestinal stromal tumors.Phase II trial of imatinib mesylate in 147 patients with advanced GIST. Reports overall response rate of 53.7% and confirms imatinib efficacy in KIT-positive GIST. Does not report individual KIT mutation genotypes for study participants.Does not name this variant
-
PMID 15451219 ↗Progression-free survival in gastrointestinal stromal tumours with high-dose imatinib: randomised trial.Phase III randomized trial (EORTC-ISG-AGITG) of 946 patients comparing imatinib 400 mg once vs twice daily in advanced GIST. Reports significantly longer progression-free survival with 800 mg daily dose and confirms imatinib efficacy. Does not report individual KIT mutation genotypes for study participants.Does not name this variant
-
PMID 16098458 ↗Outcome of patients with advanced gastro-intestinal stromal tumours crossing over to a daily imatinib dose of 800 mg after progression on 400 mg.Analysis of 133 patients from the EORTC-ISG-AGITG trial who crossed over from imatinib 400 mg to 800 mg daily after progression. Reports that 29% achieved stable disease or partial response after cross-over, with median PFS of 81 days. No variant-specific KIT mutation data reported.Does not name this variant
-
PMID 17372901 ↗L576P KIT mutation in anal melanomas correlates with KIT protein expression and is sensitive to specific kinase inhibition.Identifies heterozygous KIT exon 11 L576P substitution in 3 of 20 anal melanomas. In vitro drug testing of Ba/F3 KIT L576P transformant cells showed sensitivity to dasatinib and imatinib. This paper tested L576P, a different specific KIT exon 11 point mutation, not the in-frame deletion-insertion c.1679_1738delinsATG (p.Val560_His580delinsAspAsp).Does not name this variant
Quoted passage
A heterozygous KIT exon 11 L576P substitution was identified in 3 of 20 cases tested.
Results, page 259; Table I (KIT exon 11 primers); L576P is the only exon 11 variant characterized
Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.
gnomAD v4.1
Captured gnomAD v4.1 source record
Open source ↗
gnomAD v2.1
Captured gnomAD v2.1 source record
Open source ↗
SpliceAI Lookup
Recorded maximum delta 0.010
Open source ↗
ClinVar
Captured ClinVar source record
Open source ↗
COSMIC
Captured COSMIC source record
Open source ↗
Cancer hotspots
Captured Cancer Hotspots source record
Open source ↗
OncoKB
Captured OncoKB source record
Open source ↗
All source links
- ClinVar ↗www.ncbi.nlm.nih.gov/clinvar/?term=NM_000222.2%3Ac.1679_1738delinsATG
- gnomAD v2.1 ↗gnomad.broadinstitute.org/variant/4-55593613-TTGAGGAGATAAATGGAA…
- gnomAD v4.1 ↗gnomad.broadinstitute.org/variant/chr4-54727447-TTGAGGAGATAAATG…
- gnomAD-Canada ↗http://192.168.4.76:8001/variant/4-54727447-TTGAGGAGATAAATGGAAA…
- SpliceAI Lookup ↗spliceailookup.broadinstitute.org/#variant=NM_000222.2%3Ac.1679…
- OncoKB ↗www.oncokb.org/gene/KIT/V560_H580delinsDD
- COSMIC ↗cancer.sanger.ac.uk/cosmic/search?q=KIT+c.1679_1738delinsATG
- Cancer hotspots ↗www.cancerhotspots.org/
Statements for reports
The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.
gnomAD v4.1
Absent from gnomAD v4.1.
gnomAD v2.1
Absent from gnomAD v2.1.
gnomAD-Canada
Absent from gnomAD-Canada v1.0.
ClinVar
This variant is absent from ClinVar.
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.01).
Functional
OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Gain-of-function; curated oncogenicity label: Likely Oncogenic.
Somatic
This variant lies in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Cancer Hotspots
This variant lies in a statistically significant hotspot.