0%
PTENc.33_54delLikely pathogenic
Print report
Variant interpretation report

PTEN c.33_54del, p.(Asn12MetfsTer5)

NM_000314.6:c.33_54del NP_000305.3:p.(Asn12MetfsTer5) View identifiers
Classification
Likely pathogenic

Variant description:

No variant summary was recorded for this case.

Five-step scale from benign to pathogenic. This variant is likely pathogenic. Select a step to read what it means.

Likely pathogenic.A likely pathogenic classification under the recorded framework.

In plain language

Gene-level background from the recorded interpretation.

About PTEN

No gene-level summary was recorded for this case.

LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
01The reasoning

How it was classified

The recorded framework is ClinGen PTEN VCEP v3.2.0. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.

Recorded applied criteria

The applied criteria and their strengths are shown as assessed under the stated framework.

Pathogenic evidence criteria: 2 Benign evidence criteria: 0
Pathogenic criteria applied · 2
PVS1Very strong
PVS1 · very strong

NM_000314.6:c.33_54del is a 22 bp frameshift deletion in exon 1 producing a premature stop codon at position 16 (p.Asn12MetfsTer5), well 5' to the PTEN NMD threshold at p.D375 (c.1121). Under the PTEN VCEP PVS1 decision tree, a frameshift variant with stop codon at or 5' to p.D375 that is predicted to undergo nonsense-mediated decay in a biologically-relevant transcript is assigned PVS1 at very strong strength.

PM2Supporting
PM2 · supporting

This variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada v1.0. Under PTEN VCEP specifications, PM2 is applied at supporting strength when a variant is absent from population databases (allele frequency < 0.00001 / 0.001%).

Benign criteria applied · 0

No benign criterion marked as applied in the recorded assessment.

Recorded classification: Likely pathogenic

Richards et.al., 2015 - Combining rules v3.2.0 criteria-combination framework: matched Rule20 (1 Pathogenic.Very Strong + 1 Pathogenic.Supporting) with applied criteria: PVS1 very strong, PM2 supporting; maps to Likely Pathogenic.

02The sources

Evidence at a glance

Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.

SpliceAI score
0.130 maximum delta

Recorded SpliceAI maximum delta score: 0.130. Refer to the recorded PP3/BP4 rationale for interpretation.

No listed criterion applied SpliceAI ↗
ClinVar submissions
Not recorded

A ClinVar laboratory submission summary was not recorded.

Context only ClinVar ↗
Functional evidence
Statement recorded

OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.

No listed criterion applied OncoKB ↗
COSMIC
Cancer Hotspots
Somatic evidence
No matching record reported

This variant has not previously been reported in somatic cancers (COSMIC).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.

Context only
COSMIC ↗Cancer Hotspots ↗
For specialists

Technical detail

ACMG/AMP criteria under ClinGen PTEN VCEP v3.2.0, with the data and sources behind each one.

29 criteria with recorded statuses: 2 met · 14 not met · 0 not assessed · 13 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.

Pathogenic
PVS1PS1PS2PS3PS4PM1PM2PM3PM4PM5PM6PP1PP2PP3PP4PP5PS5
Benign
BA1BS1BS2BS3BS4BP1BP2BP3BP4BP5BP6BP7
Met Not met Not assessed Not applicable

NM_000314.6:c.33_54del is a 22 bp deletion in exon 1 of PTEN causing a frameshift (p.Asn12MetfsTer5) predicted to undergo nonsense-mediated decay, assigned PVS1 at very strong strength under the PTEN VCEP decision tree.

The variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada v1.0, meeting PM2 at supporting strength under PTEN VCEP specifications.

The variant is absent from ClinVar; no functional studies, segregation data, case observations, or de novo reports were identified in the reviewed literature.

Under the PTEN VCEP combination rules (Rule20, pathogenic track), PVS1 (Very Strong) plus one Supporting criterion (PM2_Supporting) yields a final classification of Likely Pathogenic.

Met · 2

PVS1 Very strongNM_000314.6:c.33_54del is a 22 bp frameshift deletion in exon 1 producing a premature stop codon at position 16 (p.Asn12MetfsTer5), well 5' to the PTEN NMD threshold at p.D375 (c.1121). Under the PTEN VCEP PVS1 decision tree, a frameshift variant with stop codon at or 5' to p.D375 that is predicted to undergo nonsense-mediated decay in a biologically-relevant transcript is assigned PVS1 at very strong strength. Details ▾Hide ▴
Evidence considered
  • Frameshift variant introducing premature termination codon at amino acid 16 in exon 1 of 9
  • PTEN PVS1 decision tree: stop codon at or 5' to p.D375 (c.1121) with predicted NMD → PVS1
  • Loss of function is an established disease mechanism for PTEN per CSPEC/VCEP framework
Sources
cspec ↗pvs1_variant_assessmentpvs1_gene_context
PM2 SupportingThis variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada v1.0. Under PTEN VCEP specifications, PM2 is applied at supporting strength when a variant is absent from population databases (allele frequency < 0.00001 / 0.001%). Details ▾Hide ▴
Evidence considered
  • Absent from gnomAD v2.1 (0 alleles)
  • Absent from gnomAD v4.1 (0 alleles)
  • Absent from gnomAD-Canada v1.0 (0 alleles)
Sources
gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗

Not met · 14 · evaluated, threshold not reached

PS2 No de novo observation of this variant has been reported. The variant is absent from ClinVar and no papers describe de novo occurrence. Details ▾Hide ▴
Still missing
  • No de novo data available
PS3 PTEN VCEP PS3 criteria apply to RNA/mini-gene splicing assays (Strong) or phosphatase activity via Mighell et al. 2018 saturation mutagenesis (Moderate/Supporting). No splicing assay data are available for this variant, and the Mighell et al. 2018 assay (mmc2.xlsx) covers only missense variants. This is a frameshift variant and is not represented in that dataset. Details ▾Hide ▴
Still missing
  • No functional data available for this frameshift variant
PS4 PTEN VCEP PS4 requires proband specificity scores. The variant is absent from ClinVar and no proband observations have been reported. Insufficient case-level data to apply PS4 at any strength level. Details ▾Hide ▴
Still missing
  • No proband data available
  • Variant absent from ClinVar
PM1 PTEN VCEP defines PM1 for residues in catalytic motifs: WPD loop (90-94), P-loop (123-130), and TI-loop (166-168). This frameshift occurs at codon 12 (p.Asn12MetfsTer5), well outside any catalytic domain. The variant does not lie in a mutational hotspot or critical functional domain. Details ▾Hide ▴
Evidence considered
  • Variant at codon 12 does not fall within PTEN catalytic motifs (90-94
  • 123-130
  • 166-168)
  • Not located in a statistically significant hotspot region
PM6 No assumed de novo observations have been reported for this variant. The variant is absent from ClinVar and no publications describe de novo occurrence. Details ▾Hide ▴
Still missing
  • No de novo data available
PP1 No co-segregation data are available for this variant. No family studies or meiotic data have been reported. Details ▾Hide ▴
Still missing
  • No segregation data available
PP3 PTEN VCEP PP3 applies to splicing variants with SpliceAI/VarSeak concordance or missense variants with REVEL > 0.7. SpliceAI max delta score is 0.13 (well below pathogenic threshold of 0.5). REVEL is not applicable (this is an indel, not a single nucleotide variant). No multiple lines of computational evidence support a deleterious effect. Details ▾Hide ▴
Evidence considered
  • SpliceAI max delta score: 0.13 (below pathogenic threshold of 0.5)
  • REVEL not available (not a single nucleotide variant)
Sources
spliceai ↗
BA1 PTEN VCEP BA1 requires gnomAD filtering allele frequency > 0.00056 (0.056%). This variant is absent from all gnomAD datasets. Details ▾Hide ▴
Evidence considered
  • Variant is absent from gnomAD (AF = 0)
Sources
gnomad_v2 ↗gnomad_v4 ↗
BS1 PTEN VCEP BS1 requires gnomAD filtering allele frequency ≥ 0.0000043 (0.00043%) for supporting or ≥ 0.000043 (0.0043%) for strong. This variant is absent from all gnomAD datasets. Details ▾Hide ▴
Evidence considered
  • Variant is absent from gnomAD (AF = 0)
Sources
gnomad_v2 ↗gnomad_v4 ↗
BS2 PTEN VCEP BS2 requires observation in the homozygous state in a healthy or PHTS-unaffected individual. No such observations have been reported. Details ▾Hide ▴
Still missing
  • No evidence of homozygous observation in healthy individuals
BS3 PTEN VCEP BS3 applies to intronic/synonymous variants showing no splicing impact (Strong) or phosphatase activity > 0 via Mighell et al. 2018 (Supporting). No experimental data demonstrate an absence of damaging effect for this variant. The Mighell et al. assay is limited to missense variants. Details ▾Hide ▴
Still missing
  • No functional data demonstrating benign effect
BS4 PTEN VCEP BS4 requires lack of segregation in affected family members. No segregation data are available for this variant. Details ▾Hide ▴
Still missing
  • No segregation data available
BP2 PTEN VCEP BP2 requires observation in trans with a pathogenic/likely pathogenic PTEN variant or at least three observations in cis/unknown phase with different P/LP variants. No such observations have been reported. Details ▾Hide ▴
Still missing
  • No trans or cis phase data with other PTEN P/LP variants
BP5 PTEN VCEP BP5 requires at least two cases where the variant is found with an alternate molecular basis for disease. No such cases have been reported for this variant. Details ▾Hide ▴
Still missing
  • No evidence of alternate molecular diagnosis
Not applicable · 13· recorded as not applicable Show reasons ▾Hide reasons ▴
PS1 N/APS1 applies to same amino acid change as a known pathogenic variant or different variant at same nucleotide position. This is a 22 bp frameshift deletion, not a single nucleotide substitution, and does not produce a missense change that can be compared with known pathogenic missense variants. Details ▾Hide ▴

No further detail was recorded.

PM3 VCEPPM3 is not applicable to PTEN — PTEN is an autosomal dominant disorder gene (PHTS) and this rule is for recessive disorders per PTEN VCEP specification. Details ▾Hide ▴

No further detail was recorded.

PM4 N/APTEN VCEP PM4 applies to in-frame deletions/insertions impacting catalytic motif residues or variants causing protein extension. This variant is a 22 bp out-of-frame (frameshift) deletion causing premature truncation at codon 16, not an in-frame change. PM4 is not applicable to frameshift variants. Details ▾Hide ▴

No further detail was recorded.

PM5 N/APTEN VCEP PM5 applies to missense changes at a residue where a different pathogenic missense change has been reported. This is a frameshift variant, not a missense substitution. PM5 candidate analysis confirmed no comparator variants applicable. Details ▾Hide ▴
Sources
pm5_candidates
PP2 N/APTEN VCEP PP2 applies to missense variants in a gene with low rate of benign missense variation where missense variants are a common disease mechanism. This is a frameshift variant, not a missense change. Details ▾Hide ▴

No further detail was recorded.

PP4 VCEPPP4 is designated not applicable by the ClinGen PTEN VCEP — phenotype specificity has been incorporated into PS4 rule specifications. Details ▾Hide ▴

No further detail was recorded.

PP5 VCEPPP5 is designated not applicable by the ClinGen PTEN VCEP — this criterion is not for use as recommended by the ClinGen Sequence Variant Interpretation VCEP Review Committee. Details ▾Hide ▴

No further detail was recorded.

BP1 VCEPBP1 is designated not applicable to PTEN by the ClinGen PTEN VCEP. Details ▾Hide ▴

No further detail was recorded.

BP3 VCEPBP3 is designated not applicable to PTEN by the ClinGen PTEN VCEP. This rule for in-frame deletions/insertions in repetitive regions is not applicable to this gene. Details ▾Hide ▴

No further detail was recorded.

BP4 N/APTEN VCEP BP4 applies to synonymous or intronic variants where SpliceAI and VarSeak predict no splicing impact, or missense variants with REVEL < 0.5. This is a coding frameshift deletion, not a synonymous/intronic variant, and REVEL is not applicable. Details ▾Hide ▴

No further detail was recorded.

BP6 VCEPBP6 is designated not applicable by the ClinGen PTEN VCEP — this criterion is not for use as recommended by the ClinGen Sequence Variant Interpretation VCEP Review Committee. Details ▾Hide ▴

No further detail was recorded.

BP7 N/APTEN VCEP BP7 applies to synonymous or intronic variants at or beyond +7/-21 for which splicing algorithms predict no impact. This is a 22 bp coding frameshift deletion, not a synonymous or deep intronic variant. Details ▾Hide ▴

No further detail was recorded.

PS5 N/APS5 is designated not applicable by the ClinGen PTEN VCEP — this criterion is not for use as recommended by the ClinGen Sequence Variant Interpretation VCEP Review Committee. Details ▾Hide ▴

No further detail was recorded.

Identifiers

Gene
PTEN
Transcript
NM_000314.6
Coding (HGVS c.)
NM_000314.6:c.33_54del
Protein (HGVS p.)
NP_000305.3:p.(Asn12MetfsTer5)
GRCh38
chr10:87864499 CAGAAACAAAAGGAGATATCAAG>C
GRCh37
chr10:89624256 CAGAAACAAAAGGAGATATCAAG>C

Gene diagram

Every interpreted variant in PTEN, mapped onto the exon structure of NM_000314.6. Select a row to find it on the plot.

PTENNM_000314.6
Fetching transcript structure from UCSC…
gnomAD v4.1 Allele count data not recorded
gnomAD v2.1 Allele count data not recorded
gnomAD-Canada v1.0 Allele count data not recorded

Statements

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

SpliceAI and Pangolin

SpliceAI acceptor lossat -45 bp
0.130
SpliceAI acceptor gainat -249 bp
0.060
SpliceAI donor lossat +49 bp
0.060
SpliceAI donor gainat +138 bp
0.070
Pangolin splice lossmagnitude shown
-0.170
Pangolin splice gain
0.010

Other predictors

REVEL
Not available
BayesDel
Not available

How the predictions were used

PP3 PTEN VCEP PP3 applies to splicing variants with SpliceAI/VarSeak concordance or missense variants with REVEL > 0.7. SpliceAI max delta score is 0.13 (well below pathogenic threshold of 0.5). REVEL is not applicable (this is an indel, not a single nucleotide variant). No multiple lines of computational evidence support a deleterious effect. Details ▾Hide ▴
Evidence considered
  • SpliceAI max delta score: 0.13 (below pathogenic threshold of 0.5)
  • REVEL not available (not a single nucleotide variant)
Sources
spliceai ↗
BP4 N/APTEN VCEP BP4 applies to synonymous or intronic variants where SpliceAI and VarSeak predict no splicing impact, or missense variants with REVEL < 0.5. This is a coding frameshift deletion, not a synonymous/intronic variant, and REVEL is not applicable. Details ▾Hide ▴

No further detail was recorded.

BP7 N/APTEN VCEP BP7 applies to synonymous or intronic variants at or beyond +7/-21 for which splicing algorithms predict no impact. This is a 22 bp coding frameshift deletion, not a synonymous or deep intronic variant. Details ▾Hide ▴

No further detail was recorded.

Statement

In silico

SpliceAI predicts no significant splice impact for this variant (max delta score = 0.13).

2 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata. None of the listed paper records explicitly indicates that the variant is named.

Recorded publications

  • PTEN: life as a tumor suppressor.
    Reviews PTEN function as a tumor suppressor, discussing its role in the PI3K/AKT pathway and cancer syndromes. NM_000314.6:c.33_54del was not identified in this paper.
    Does not name this variant
    PMID 11237521 ↗
  • Essential role for nuclear PTEN in maintaining chromosomal integrity.
    Reports a nuclear function for PTEN in maintaining chromosomal integrity. NM_000314.6:c.33_54del was not identified in this paper.
    Does not name this variant
    PMID 17218262 ↗

Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.

gnomAD v4.1 Captured gnomAD v4.1 source record Open source ↗
gnomAD v2.1 Captured gnomAD v2.1 source record Open source ↗
SpliceAI Lookup Recorded maximum delta 0.130 Open source ↗
ClinVar Captured ClinVar source record Open source ↗
COSMIC Captured COSMIC source record Open source ↗
Cancer hotspots Captured Cancer Hotspots source record Open source ↗
OncoKB Captured OncoKB source record Open source ↗
ClinGen CSpec Captured ClinGen CSpec source record Open source ↗

All source links

Statements for reports

The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

ClinVar

This variant is absent from ClinVar.

In silico

SpliceAI predicts no significant splice impact for this variant (max delta score = 0.13).

Functional

OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.

Somatic

This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.