About PTEN
No gene-level summary was recorded for this case.
Previous versions
Variant interpretation report
PTEN c.101_126del, p.(Ala34GlyfsTer9)
Classification
Likely pathogenic
Variant description:
No variant summary was recorded for this case.
Five-step scale from benign to pathogenic. This variant is likely pathogenic. Select a step to read what it means.
Likely pathogenic.A likely pathogenic classification under the recorded framework.
In plain language
Gene-level background from the recorded interpretation.
Words with a dotted underline have a short definition. Hover or tap them.
LYFE Sciences is an AI system, and it can make mistakes.
Criteria may be applied incorrectly, sources may be misread, and a
confident-looking classification can still be wrong.
Double-check every criterion and its underlying evidence
before relying on any call.
01The reasoning
How it was classified
The recorded framework is ClinGen PTEN VCEP v3.2.0. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.
Recorded applied criteria
The applied criteria and their strengths are shown as assessed under the stated framework.
Pathogenic evidence criteria: 2
Benign evidence criteria: 0
Pathogenic criteria applied · 2
PVS1Very strong
PVS1 · very strong
This variant is an early frameshift deletion in PTEN, NM_000314.8:c.101_126del, predicted to cause p.(Ala34GlyfsTer9) [p.(A34Gfs*9)]. Under the PTEN-specific PVS1 decision tree, a frameshift at or 5' to p.D375 in the biologically relevant transcript NM_000314.8 is assigned PVS1, and this predicted truncation is far upstream of that threshold and expected to undergo nonsense-mediated decay.
PM2Supporting
PM2 · supporting
This variant is absent from gnomAD v2.1 and gnomAD v4.1. This population frequency is below the PTEN Expert Panel PM2 threshold of <0.00001 (0.001%), supporting PM2 at the supporting level.
Benign criteria applied · 0
No benign criterion marked as applied in the recorded assessment.
Recorded classification: Likely pathogenic
Richards et.al., 2015 - Combining rules v3.2.0 criteria-combination framework: matched Rule20 (1 Pathogenic.Very Strong + 1 Pathogenic.Supporting) with applied criteria: PVS1 very strong, PM2 supporting; maps to Likely Pathogenic.
02The sources
Evidence at a glance
Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.
gnomAD v4.1
gnomAD v2.1
Population frequency
Not recorded
gnomAD v4.1 allele counts were not recorded for this variant.
gnomAD v2.1
Absent from gnomAD v2.1.
No screenshot for this evidence
Computational predictions
Not recorded
No SpliceAI or REVEL score is recorded in the fields used for this tile.
No listed criterion applied
ClinVar submissions
Not recorded
A ClinVar laboratory submission summary was not recorded.
Context only
ClinVar ↗
Functional evidence
Statement recorded
OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.
No listed criterion applied
OncoKB ↗
COSMIC
Cancer Hotspots
Somatic evidence
Not assessed
No COSMIC evidence statement is recorded in this case.
Cancer Hotspots
This variant does not lie in a statistically significant hotspot.
Context only
For specialists
Technical detail
ACMG/AMP criteria under ClinGen PTEN VCEP v3.2.0, with the data and sources behind each one.
28 criteria with recorded statuses: 2 met · 4 not met · 11 not assessed · 11 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.
Met
Not met
Not assessed
Not applicable
The PTEN c.101_126del (p.Ala34GlyfsTer9; p.A34Gfs*9) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar.
This variant is absent from gnomAD v2.1 and gnomAD v4.1, placing it below the PTEN Expert Panel PM2 threshold of <0.00001 (0.001%) and supporting PM2 at the supporting level.
No direct functional study of this exact deletion was identified, and the PTEN phosphatase activity assay resource curated by the Expert Panel applies to missense variants rather than this frameshift variant.
This deletion causes an early frameshift predicted to produce p.(Ala34GlyfsTer9) [p.(A34Gfs*9)]; under the PTEN PVS1 decision tree, a truncating variant 5' to p.D375 in NM_000314.8 supports PVS1, and SpliceAI also predicts possible splice impact with a maximum delta score of 0.51.
No criteria match.
Met · 2
PVS1 Very strongThis variant is an early frameshift deletion in PTEN, NM_000314.8:c.101_126del, predicted to cause p.(Ala34GlyfsTer9) [p.(A34Gfs*9)]. Under the PTEN-specific PVS1 decision tree, a frameshift at or 5' to p.D375 in the biologically relevant transcript NM_000314.8 is assigned PVS1, and this predicted truncation is far upstream of that threshold and expected to undergo nonsense-mediated decay. Details ▾Hide ▴
Rule
PTEN VCEP PVS1 decision tree: frameshift at or 5' to p.D375 in NM_000314.8 -> PVS1
Evidence considered
- Frameshift consequence p.(Ala34GlyfsTer9) / p.(A34Gfs*9)
- PTEN loss of function is an established disease mechanism in the PTEN VCEP framework
- PTEN PVS1 decision tree assigns PVS1 to frameshift variants at or 5' to p.D375 in NM_000314.8
Sources
PM2 SupportingThis variant is absent from gnomAD v2.1 and gnomAD v4.1. This population frequency is below the PTEN Expert Panel PM2 threshold of <0.00001 (0.001%), supporting PM2 at the supporting level. Details ▾Hide ▴
Rule
PTEN PM2_Supporting: absent or <0.00001 allele frequency in gnomAD/large population dataset
Evidence considered
- Absent from gnomAD v2.1
- Absent from gnomAD v4.1
- PTEN PM2 threshold is <0.00001
Sources
Not met · 4 · evaluated, threshold not reached
PM1 This variant does not meet PM1 because it affects codon 34, which is outside the PTEN catalytic motif residues defined by the PTEN Expert Panel (90-94, 123-130, and 166-168). No hotspot evidence supporting this residue as a critical mutational hotspot was identified. Details ▾Hide ▴
Rule
PTEN PM1 applies to catalytic motif residues 90-94, 123-130, 166-168
Evidence considered
- Residue affected is A34
- PTEN PM1 motifs are 90-94
- 123-130
- and 166-168
- No hotspot row was identified for A34
Sources
BA1 This variant does not meet BA1 because it is absent from gnomAD v2.1 and gnomAD v4.1, which is below the PTEN BA1 threshold of >0.00056 (0.056%). Details ▾Hide ▴
Rule
PTEN BA1: filtering allele frequency >0.00056
Evidence considered
- Absent from gnomAD v2.1
- Absent from gnomAD v4.1
- PTEN BA1 threshold is >0.00056
Sources
BS1 This variant does not meet BS1 because it is absent from gnomAD v2.1 and gnomAD v4.1, which is below the PTEN BS1 supporting range of 0.0000043-0.000043 and strong range of 0.000043-0.00056. Details ▾Hide ▴
Rule
PTEN BS1: Supporting 0.0000043-0.000043; Strong 0.000043-0.00056
Evidence considered
- Absent from gnomAD v2.1
- Absent from gnomAD v4.1
- PTEN BS1 thresholds begin at 0.0000043
Sources
BP4 This variant does not meet BP4. SpliceAI predicts possible splice impact with a maximum delta score of 0.51, which is above the PTEN benign splicing range of 0-0.2, and no concordant benign splicing prediction was identified. The REVEL-based BP4 missense rule is not applicable to this deletion. Details ▾Hide ▴
Rule
PTEN BP4 requires computational evidence for no impact; for splicing variants SpliceAI benign range is 0-0.2 with concordant prediction
Evidence considered
- SpliceAI max delta score 0.51
- PTEN BP4 benign splicing range is 0-0.2
- Variant is not missense
- so REVEL rule does not apply
Sources
Not assessed · 11 · no assessment recorded
PS2 No confirmed de novo observation was identified for this variant. Available evidence does not document maternity and paternity confirmation in an affected individual with no family history. Details ▾Hide ▴
Evidence considered
- ClinVar search returned no result for this variant
Still missing
- De novo case-level evidence with confirmed parentage was not identified.
Sources
PS3 No direct functional study of this exact deletion was identified that would support a damaging effect at the PS3 evidence level. The PTEN VCEP phosphatase assay resource is specified for missense variants, and no RNA or other functional assay result for this frameshift deletion was identified. Details ▾Hide ▴
Evidence considered
- PTEN VCEP functional assay file is missense-focused
- OncoKB linked general PTEN functional literature but no exact-variant assay evidence was retrieved
Still missing
- No variant-specific RNA or protein functional assay was identified.
Sources
PS4 No case series, enrichment study, or count of unrelated affected individuals carrying this variant was identified. The available evidence is insufficient to show that this variant is more prevalent in affected individuals than in controls. Details ▾Hide ▴
Evidence considered
- Variant absent from ClinVar
- Variant absent from gnomAD v2.1 and v4.1
Still missing
- No affected-case count or case-control enrichment data were identified for this exact variant.
Sources
PM6 No presumed de novo observation was identified for this variant. Available evidence does not show this variant arising de novo in an affected individual without confirmed parentage. Details ▾Hide ▴
Evidence considered
- ClinVar search returned no result for this variant
Still missing
- No unconfirmed de novo case report was identified.
Sources
PP1 No segregation data were identified for this variant. Available evidence does not document co-segregation with PTEN-related disease across informative meioses. Details ▾Hide ▴
Evidence considered
- ClinVar search returned no result for this variant
Still missing
- No family segregation report for this exact variant was identified.
Sources
PP3 SpliceAI predicts possible splice impact with a maximum delta score of 0.51, which is above a benign range, but the PTEN Expert Panel requires concordant splicing predictors for splicing-based PP3/BP4 use. No concordant second splicing predictor result was identified, and the missense-based REVEL rule does not apply to this deletion. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta score 0.51
- REVEL not available because this is not an SNV
- BayesDel not available because this is not an SNV
Still missing
- No concordant second splicing predictor result was identified.
- REVEL and BayesDel are not applicable to this non-SNV deletion.
Sources
BS2 No evidence was identified that this variant has been observed in the homozygous state in a healthy or PTEN hamartoma tumor syndrome-unaffected individual. Details ▾Hide ▴
Evidence considered
- Variant absent from ClinVar
- Variant absent from gnomAD v2.1 and v4.1
Still missing
- No homozygous observation in unaffected individuals was identified.
Sources
BS3 No direct functional study of this exact deletion was identified showing no damaging effect. The PTEN VCEP phosphatase assay resource is specified for missense variants, and no RNA assay showing normal splicing for this deletion was identified. Details ▾Hide ▴
Evidence considered
- PTEN VCEP functional assay resource is missense-focused
- No normal-splicing assay was identified for this deletion
Still missing
- No benign functional assay for this exact deletion was identified.
Sources
cspec ↗vcep_mmc2
BS4 No lack-of-segregation evidence was identified for this variant. Available evidence does not document clinically affected relatives who do not carry the variant or unaffected carriers in a way that would satisfy BS4. Details ▾Hide ▴
Evidence considered
- ClinVar search returned no result for this variant
Still missing
- No family non-segregation data were identified for this exact variant.
Sources
BP2 No phase data were identified showing this variant in trans with a pathogenic PTEN variant or repeated cis/phase-unknown observations with different pathogenic PTEN variants. Details ▾Hide ▴
Evidence considered
- ClinVar search returned no result for this variant
Still missing
- No phase-based case observations were identified.
Sources
BP5 No evidence was identified that this variant was found in an individual with an alternate highly penetrant molecular explanation for the phenotype and no overlap with PTEN-related disease. Details ▾Hide ▴
Evidence considered
- ClinVar search returned no result for this variant
Still missing
- No alternate molecular diagnosis with non-overlapping phenotype was identified.
Sources
Not applicable · 11· recorded as not applicable Show reasons ▾Hide reasons ▴
PS1 N/AThis criterion is not applicable because PS1 is for a different nucleotide change producing the same amino acid substitution, and this variant is a frameshift deletion rather than a shared missense or equivalent splicing event. Details ▾Hide ▴
PM3 N/AThis criterion is not applicable in the PTEN Expert Panel framework. Details ▾Hide ▴
PM4 N/AThis criterion is not applicable because PM4 is used for in-frame insertions or deletions and stop-loss variants, whereas this variant is a frameshift deletion already evaluated under PVS1. Details ▾Hide ▴
Evidence considered
- Variant is a frameshift deletion rather than an in-frame indel or stop-loss
Sources
PM5 N/AThis criterion is not applicable because PM5 is for a novel missense change at an amino acid residue where a different pathogenic missense change has been established, and this variant is a frameshift deletion. Details ▾Hide ▴
PP2 N/AThis criterion is not applicable because PP2 is a missense-based rule, and this variant is a frameshift deletion. Details ▾Hide ▴
PP4 N/AThis criterion is not applicable in the PTEN Expert Panel framework because phenotype specificity is incorporated into PS4 usage. Details ▾Hide ▴
PP5 N/AThis criterion is not applicable in the PTEN Expert Panel framework. Details ▾Hide ▴
BP1 N/AThis criterion is not applicable in the PTEN Expert Panel framework. Details ▾Hide ▴
BP3 N/AThis criterion is not applicable in the PTEN Expert Panel framework. Details ▾Hide ▴
BP6 N/AThis criterion is not applicable in the PTEN Expert Panel framework. Details ▾Hide ▴
BP7 N/AThis criterion is not applicable because BP7 is for synonymous or qualifying intronic variants, and this variant is an exonic frameshift deletion. Details ▾Hide ▴
Identifiers
- Gene
- PTEN
- Transcript
- NM_000314.8
- Coding (HGVS c.)
- NM_000314.8:c.101_126del
- Protein (HGVS p.)
- NP_000305.3:p.(Ala34GlyfsTer9)
- GRCh38
- chr10:87894045 GCTATGGGATTTCCTGCAGAAAGACTT>G
- GRCh37
- chr10:89653802 GCTATGGGATTTCCTGCAGAAAGACTT>G
Gene diagram
Every interpreted variant in PTEN, mapped onto the exon structure of NM_000314.8. Select a row to find it on the plot.
PTENNM_000314.8
Fetching transcript structure from UCSC…
Exons
—
Transcript span
—
Strand
—
Variants mapped
—
Source
UCSC ncbiRefSeqCurated
All variants in PTEN
—
Select a row to find it on the plot; use the link to open its page.
| Protein | Location | Classification | Link |
|---|
gnomAD v4.1
Allele count data not recorded
gnomAD v2.1
Allele count data not recorded
Statements
gnomAD v4.1
Absent from gnomAD v4.1.
gnomAD v2.1
Absent from gnomAD v2.1.
Other predictors
- REVEL
- Not available
- BayesDel
- Not available
How the predictions were used
BP4 This variant does not meet BP4. SpliceAI predicts possible splice impact with a maximum delta score of 0.51, which is above the PTEN benign splicing range of 0-0.2, and no concordant benign splicing prediction was identified. The REVEL-based BP4 missense rule is not applicable to this deletion. Details ▾Hide ▴
Rule
PTEN BP4 requires computational evidence for no impact; for splicing variants SpliceAI benign range is 0-0.2 with concordant prediction
Evidence considered
- SpliceAI max delta score 0.51
- PTEN BP4 benign splicing range is 0-0.2
- Variant is not missense
- so REVEL rule does not apply
Sources
PP3 SpliceAI predicts possible splice impact with a maximum delta score of 0.51, which is above a benign range, but the PTEN Expert Panel requires concordant splicing predictors for splicing-based PP3/BP4 use. No concordant second splicing predictor result was identified, and the missense-based REVEL rule does not apply to this deletion. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta score 0.51
- REVEL not available because this is not an SNV
- BayesDel not available because this is not an SNV
Still missing
- No concordant second splicing predictor result was identified.
- REVEL and BayesDel are not applicable to this non-SNV deletion.
Sources
BP7 N/AThis criterion is not applicable because BP7 is for synonymous or qualifying intronic variants, and this variant is an exonic frameshift deletion. Details ▾Hide ▴
Statement
In silico
SpliceAI predicts possible splice impact for this variant (max delta score = 0.51).
0 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata.
Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.
gnomAD v4.1
Captured gnomAD v4.1 source record
Open source ↗
gnomAD v2.1
Captured gnomAD v2.1 source record
Open source ↗
SpliceAI Lookup
Captured SpliceAI source record
Open source ↗
ClinVar
Captured ClinVar source record
Open source ↗
COSMIC
Captured COSMIC source record
Open source ↗
Cancer hotspots
Captured Cancer Hotspots source record
Open source ↗
OncoKB
Captured OncoKB source record
Open source ↗
ClinGen CSpec
Captured ClinGen CSpec source record
Open source ↗
All source links
- ClinGen CSpec ↗cspec.genome.network/cspec/ui/svi/doc/135637575
- ClinVar ↗www.ncbi.nlm.nih.gov/clinvar/?term=NM_000314.8%3Ac.101_126del
- gnomAD v2.1 ↗gnomad.broadinstitute.org/variant/10-89653802-GCTATGGGATTTCCTGC…
- gnomAD v4.1 ↗gnomad.broadinstitute.org/variant/chr10-87894045-GCTATGGGATTTCC…
- SpliceAI Lookup ↗spliceailookup.broadinstitute.org/#variant=NM_000314.8%3Ac.101_…
- OncoKB ↗www.oncokb.org/gene/PTEN/A34Gfs*9
- COSMIC ↗cancer.sanger.ac.uk/cosmic/search?q=PTEN+c.101_126del
- Cancer hotspots ↗www.cancerhotspots.org/
Statements for reports
The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.
gnomAD v4.1
Absent from gnomAD v4.1.
gnomAD v2.1
Absent from gnomAD v2.1.
ClinVar
This variant is absent from ClinVar.
In silico
SpliceAI predicts possible splice impact for this variant (max delta score = 0.51).
Functional
OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.
Somatic
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Cancer Hotspots
This variant does not lie in a statistically significant hotspot.