About PTEN
No gene-level summary was recorded for this case.
Previous versions
Variant interpretation report
PTEN c.129_155del, p.(Glu43_Asp51del)
Classification
Uncertain significance
Variant description:
No variant summary was recorded for this case.
Five-step scale from benign to pathogenic. This variant is uncertain. Select a step to read what it means.
Uncertain.The recorded classification is uncertain significance.
In plain language
Gene-level background from the recorded interpretation.
Words with a dotted underline have a short definition. Hover or tap them.
LYFE Sciences is an AI system, and it can make mistakes.
Criteria may be applied incorrectly, sources may be misread, and a
confident-looking classification can still be wrong.
Double-check every criterion and its underlying evidence
before relying on any call.
01The reasoning
How it was classified
The recorded framework is ClinGen PTEN VCEP v3.2. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.
Recorded applied criteria
The applied criteria and their strengths are shown as assessed under the stated framework.
Pathogenic evidence criteria: 1
Benign evidence criteria: 0
Pathogenic criteria applied · 1
PM2Supporting
PM2 · supporting
The variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada, meeting the PTEN EP threshold for PM2_Supporting (allele frequency <0.001%).
Benign criteria applied · 0
No benign criterion marked as applied in the recorded assessment.
Recorded classification: Uncertain significance
ClinGen PTEN Expert Panel Specifications to the ACMG/AMP Variant Interpretation Guidelines for PTEN Version 3.2 v3.2 criteria-combination framework was evaluated deterministically with applied criteria: PM2 supporting; no rule matched the adjudicated criteria.
02The sources
Evidence at a glance
Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.
gnomAD v4.1
gnomAD v2.1
Population frequency
Not recorded
gnomAD v4.1 allele counts were not recorded for this variant.
gnomAD v2.1
Absent from gnomAD v2.1.
gnomAD-Canada
Absent from gnomAD-Canada v1.0.
SpliceAI score
0.617 maximum delta
Recorded SpliceAI maximum delta score: 0.617. Refer to the recorded PP3/BP4 rationale for interpretation.
No listed criterion applied
SpliceAI ↗
ClinVar submissions
Not recorded
A ClinVar laboratory submission summary was not recorded.
Context only
ClinVar ↗
Functional evidence
Statement recorded
OncoKB did not identify variant-specific reviewed functional evidence for this variant; gene-level curated context is available for reviewer follow-up. PTEN, a lipid and protein phosphatase, is one of the most frequently mutated genes in cancer.
No listed criterion applied
OncoKB ↗
COSMIC
Cancer Hotspots
Somatic evidence
No matching record reported
This variant has not previously been reported in somatic cancers (COSMIC).
Cancer Hotspots
This variant does not lie in a statistically significant hotspot.
Context only
For specialists
Technical detail
ACMG/AMP criteria under ClinGen PTEN VCEP v3.2, with the data and sources behind each one.
29 criteria with recorded statuses: 1 met · 17 not met · 0 not assessed · 11 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.
Met
Not met
Not assessed
Not applicable
NM_000314.8:c.129_155del (NP_000305.3:p.(Glu43_Asp51del)) is an in-frame deletion of nine amino acids in exon 2 of PTEN.
The variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada, meeting the PTEN Expert Panel threshold for PM2_Supporting.
The variant is absent from ClinVar, and no proband, de novo, or co-segregation data are available.
The deleted residues Glu43-Asp51 lie outside the PTEN catalytic motifs (90-94, 123-130, 166-168), so PM1 and PM4 are not met, and the in-frame deletion is not a null variant for PVS1.
The exact 9-residue deletion was not assayed in the Mighell et al. saturation mutagenesis data, so PS3 is not met; single-amino-acid deletions at Glu43 and Asp51 are strongly damaging but do not directly test the multi-residue deletion.
Overall, only PM2_Supporting is met, which is insufficient to reach Likely Pathogenic under the PTEN Expert Panel combination rules; the variant is classified as a Variant of Uncertain Significance.
No criteria match.
Met · 1
PM2 SupportingThe variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada, meeting the PTEN EP threshold for PM2_Supporting (allele frequency <0.001%). Details ▾Hide ▴
Evidence considered
- Absent from gnomAD v2.1 (exome).
- Absent from gnomAD v4.1 (exome).
- Absent from gnomAD-Canada v1.0 (AC 0
- AN 0).
Still missing
- The 27 bp deletion may be poorly called by short-read NGS
- so absence from gnomAD is a weaker signal than for a single-nucleotide variant (ACMG/AMP PM2 caveat).
Sources
Not met · 17 · evaluated, threshold not reached
PS1 No previously established pathogenic variant with the same amino acid change (p.Glu43_Asp51del) is reported; the variant is absent from ClinVar. Details ▾Hide ▴
Evidence considered
- The variant is absent from ClinVar with no established pathogenic comparator.
Still missing
- No ClinVar or literature comparator with the identical in-frame deletion.
Sources
PS2 No de novo observation (with maternity and paternity confirmed) has been reported for this variant. Details ▾Hide ▴
Evidence considered
- No de novo report identified in ClinVar or the literature for this variant.
Still missing
- No family or parental testing data available.
Sources
PS3 The PTEN EP PS3_Moderate rule requires locating the variant in the Mighell et al. 2018 saturation mutagenesis table (Table S2); that table contains only single-residue missense, nonsense, and single-amino-acid deletions, so the exact 9-residue deletion p.Glu43_Asp51del was not directly assayed. Details ▾Hide ▴
Evidence considered
- Mighell et al. 2018 (PMID:29706350) Table S2 contains no multi-residue deletion entry for p.Glu43_Asp51del.
- Single-amino-acid deletions at the deletion boundaries are strongly damaging (Glu43Del Cum_score -3.07
- Asp51Del Cum_score -3.44
- both high-confidence)
- but these test individual residues
- not the 9-residue deletion as a unit.
Still missing
- The exact 9-residue in-frame deletion was not directly functionally assayed
- only single-residue deletions at Glu43 and Asp51 were measured and are strongly damaging.
Sources
vcep_mmc2
PS4 The variant is absent from ClinVar with no affected probands, so prevalence in affected individuals cannot be assessed. Details ▾Hide ▴
Evidence considered
- The variant is absent from ClinVar
- no proband or case-control data are available.
Still missing
- No affected proband or case-control prevalence data.
Sources
PM1 The deleted residues (Glu43-Asp51) lie in the N-terminal region and are outside the PTEN catalytic motifs defined for PM1 (WPD loop 90-94, P-loop 123-130, TI-loop 166-168). Details ▾Hide ▴
Evidence considered
- PTEN EP PM1 specification restricts application to catalytic motif residues 90-94
- 123-130
- and 166-168 (NP_000305.3).
Sources
PM4 Although this is an in-frame deletion in a non-repeat region, the PTEN EP PM4 specification limits application to in-frame insertions/deletions impacting at least one catalytic-motif residue; residues Glu43-Asp51 are outside those motifs (90-94, 123-130, 166-168). Details ▾Hide ▴
Evidence considered
- PTEN EP PM4 specification requires the in-frame deletion to impact at least one catalytic motif residue (see PM1).
Sources
PM6 No assumed de novo observation (without confirmation of paternity/maternity) has been reported for this variant. Details ▾Hide ▴
Evidence considered
- No de novo report identified in ClinVar or the literature.
Still missing
- No de novo observation data available.
Sources
PP1 No co-segregation data in affected family members is available for this variant. Details ▾Hide ▴
Evidence considered
- No family segregation data available.
Still missing
- No segregation/meiosis data.
PP3 PP3 requires multiple concordant lines of computational evidence (REVEL >0.7 for missense, or SpliceAI plus VarSeak concordance for splicing); REVEL is unavailable for this non-SNV and VarSeak was not run, so the requirement is not satisfied. Details ▾Hide ▴
Evidence considered
- SpliceAI predicts possible donor loss (max delta 0.617
- DS_DL 0.617)
- but this single in silico prediction does not meet the VCEP requirement for concordant SpliceAI + VarSeak evidence.
- REVEL/BayesDel are unavailable (non-SNV).
Still missing
- VarSeak and REVEL scores not available for this deletion.
Sources
BA1 The variant is absent from gnomAD, so the filtering allele frequency threshold for BA1 (>0.056%) is not met. Details ▾Hide ▴
BS1 The variant is absent from gnomAD, so the BS1 allele frequency range (0.0043%-0.056%) is not met. Details ▾Hide ▴
BS2 The variant has not been observed in the homozygous state in a healthy or PHTS-unaffected individual. Details ▾Hide ▴
Evidence considered
- No homozygous observations (variant absent from gnomAD).
Sources
BS3 No functional study demonstrates a benign effect on protein function; the exact deletion is not in the Mighell saturation mutagenesis table. Details ▾Hide ▴
Evidence considered
- No functional data showing no damaging effect for this variant.
Still missing
- No benign functional data available.
Sources
vcep_mmc2
BS4 No data on lack of segregation in affected family members is available. Details ▾Hide ▴
Evidence considered
- No segregation data available.
Still missing
- No family data available.
BP2 No observation of this variant in trans or in cis with a pathogenic/likely pathogenic PTEN variant has been reported. Details ▾Hide ▴
Evidence considered
- No in trans or in cis phase data available.
Still missing
- No phase data available.
BP4 Computational evidence does not suggest no impact; SpliceAI predicts possible donor loss (max delta 0.617), and no REVEL score is available, so BP4 is not supported. Details ▾Hide ▴
Evidence considered
- SpliceAI predicts possible splice impact (DS_DL 0.617)
- contrary to a benign computational signal.
Sources
BP5 No case with an alternate molecular basis for disease has been identified for this variant. Details ▾Hide ▴
Evidence considered
- No alternate molecular basis data available.
Still missing
- No alternate molecular basis data.
Not applicable · 11· recorded as not applicable Show reasons ▾Hide reasons ▴
PVS1 N/ANM_000314.8:c.129_155del is an in-frame deletion removing nine amino acids (p.Glu43_Asp51del) without disrupting the reading frame; it is not a null variant (nonsense, frameshift, canonical splice site, or exon-level deletion) and therefore falls outside the PTEN PVS1 decision tree. Details ▾Hide ▴
Evidence considered
- PTEN PVS1 decision tree applies only to nonsense
- frameshift
- canonical GT-AG splice site disruptions
- and single/multi-exon deletions.
- pvs1_variant_assessment.json classifies the variant as bucket 'other' and does not route it through a null-variant framework.
Sources
vcep_pvs1_decisiontree_ptenpvs1_variant_assessment
PM3 VCEPPTEN causes autosomal dominant PTEN hamartoma tumor syndrome; PM3 (recessive trans requirement) is not applicable. Details ▾Hide ▴
PM5 N/APM5 applies to a missense change at a residue with a different established pathogenic missense; this is an in-frame deletion, not a missense variant. Details ▾Hide ▴
Evidence considered
- pm5_candidates.json confirms classic same-residue missense PM5 is not applicable to this non-missense variant.
Sources
pm5_candidates
PP2 N/APP2 applies to missense variants in a gene with a low rate of benign missense variation; this is an in-frame deletion, not a missense variant. Details ▾Hide ▴
PP4 VCEPPP4 is not applicable per the PTEN Expert Panel (phenotype specificity is incorporated into PS4). Details ▾Hide ▴
PP5 VCEPPP5 is not for use per the PTEN Expert Panel, and the variant is absent from ClinVar (no reputable-source pathogenic classification). Details ▾Hide ▴
BP1 VCEPBP1 (missense variant in a gene where primarily truncating variants cause disease) is not applicable to PTEN per the Expert Panel. Details ▾Hide ▴
BP3 VCEPBP3 (in-frame deletion in a repetitive region without known function) is not applicable to PTEN per the Expert Panel. Details ▾Hide ▴
BP6 VCEPBP6 is not for use per the PTEN Expert Panel, and the variant is absent from ClinVar (no reputable-source benign classification). Details ▾Hide ▴
BP7 N/ABP7 applies to synonymous or intronic variants with no predicted splice impact; this is an in-frame deletion, not a synonymous/intronic variant. Details ▾Hide ▴
PS5 N/APS5 is not defined in the PTEN Expert Panel specifications or the ACMG/AMP framework. Details ▾Hide ▴
No further detail was recorded.
Identifiers
- Gene
- PTEN
- Transcript
- NM_000314.8
- Coding (HGVS c.)
- NM_000314.8:c.129_155del
- Protein (HGVS p.)
- NP_000305.3:p.(Glu43_Asp51del)
- GRCh38
- chr10:87894070 TTGAAGGCGTATACAGGAACAATATTGA>T
- GRCh37
- chr10:89653827 TTGAAGGCGTATACAGGAACAATATTGA>T
Gene diagram
Every interpreted variant in PTEN, mapped onto the exon structure of NM_000314.8. Select a row to find it on the plot.
PTENNM_000314.8
Fetching transcript structure from UCSC…
Exons
—
Transcript span
—
Strand
—
Variants mapped
—
Source
UCSC ncbiRefSeqCurated
All variants in PTEN
—
Select a row to find it on the plot; use the link to open its page.
| Protein | Location | Classification | Link |
|---|
gnomAD v4.1
Allele count data not recorded
gnomAD v2.1
Allele count data not recorded
gnomAD-Canada v1.0
Allele count data not recorded
Statements
gnomAD v4.1
Absent from gnomAD v4.1.
gnomAD v2.1
Absent from gnomAD v2.1.
gnomAD-Canada
Absent from gnomAD-Canada v1.0.
SpliceAI and Pangolin
Other predictors
- REVEL
- Not available
- BayesDel
- Not available
How the predictions were used
PP3 PP3 requires multiple concordant lines of computational evidence (REVEL >0.7 for missense, or SpliceAI plus VarSeak concordance for splicing); REVEL is unavailable for this non-SNV and VarSeak was not run, so the requirement is not satisfied. Details ▾Hide ▴
Evidence considered
- SpliceAI predicts possible donor loss (max delta 0.617
- DS_DL 0.617)
- but this single in silico prediction does not meet the VCEP requirement for concordant SpliceAI + VarSeak evidence.
- REVEL/BayesDel are unavailable (non-SNV).
Still missing
- VarSeak and REVEL scores not available for this deletion.
Sources
BP4 Computational evidence does not suggest no impact; SpliceAI predicts possible donor loss (max delta 0.617), and no REVEL score is available, so BP4 is not supported. Details ▾Hide ▴
Evidence considered
- SpliceAI predicts possible splice impact (DS_DL 0.617)
- contrary to a benign computational signal.
Sources
BP7 N/ABP7 applies to synonymous or intronic variants with no predicted splice impact; this is an in-frame deletion, not a synonymous/intronic variant. Details ▾Hide ▴
Statement
In silico
SpliceAI predicts possible splice impact for this variant (max delta score = 0.62).
0 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata.
Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.
gnomAD v4.1
Captured gnomAD v4.1 source record
Open source ↗
gnomAD v2.1
Captured gnomAD v2.1 source record
Open source ↗
SpliceAI Lookup
Recorded maximum delta 0.617
Open source ↗
ClinVar
Captured ClinVar source record
Open source ↗
COSMIC
Captured COSMIC source record
Open source ↗
Cancer hotspots
Captured Cancer Hotspots source record
Open source ↗
OncoKB
Captured OncoKB source record
Open source ↗
ClinGen CSpec
Captured ClinGen CSpec source record
Open source ↗
All source links
- ClinGen CSpec ↗cspec.genome.network/cspec/ui/svi/doc/135637575
- ClinVar ↗www.ncbi.nlm.nih.gov/clinvar/?term=NM_000314.8%3Ac.129_155del
- gnomAD v2.1 ↗gnomad.broadinstitute.org/variant/10-89653827-TTGAAGGCGTATACAGG…
- gnomAD v4.1 ↗gnomad.broadinstitute.org/variant/chr10-87894070-TTGAAGGCGTATAC…
- gnomAD-Canada ↗http://192.168.4.76:8001/variant/10-87894070-TTGAAGGCGTATACAGGA…
- SpliceAI Lookup ↗spliceailookup.broadinstitute.org/#variant=NM_000314.8%3Ac.129_…
- OncoKB ↗www.oncokb.org/gene/PTEN/E43_D51del
- COSMIC ↗cancer.sanger.ac.uk/cosmic/search?q=PTEN+c.129_155del
- Cancer hotspots ↗www.cancerhotspots.org/
Statements for reports
The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.
gnomAD v4.1
Absent from gnomAD v4.1.
gnomAD v2.1
Absent from gnomAD v2.1.
gnomAD-Canada
Absent from gnomAD-Canada v1.0.
ClinVar
This variant is absent from ClinVar.
In silico
SpliceAI predicts possible splice impact for this variant (max delta score = 0.62).
Functional
OncoKB did not identify variant-specific reviewed functional evidence for this variant; gene-level curated context is available for reviewer follow-up. PTEN, a lipid and protein phosphatase, is one of the most frequently mutated genes in cancer.
Somatic
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Cancer Hotspots
This variant does not lie in a statistically significant hotspot.