0%
PTENc.324_354delLikely pathogenic
Print report
Variant interpretation report

PTEN c.324_354del, p.(Asp109LeufsTer15)

NM_000314.8:c.324_354del NP_000305.3:p.(Asp109LeufsTer15) View identifiers
Classification
Likely pathogenic

Variant description:

No variant summary was recorded for this case.

Five-step scale from benign to pathogenic. This variant is likely pathogenic. Select a step to read what it means.

Likely pathogenic.A likely pathogenic classification under the recorded framework.

In plain language

Gene-level background from the recorded interpretation.

About PTEN

No gene-level summary was recorded for this case.

LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
01The reasoning

How it was classified

The recorded framework is ClinGen PTEN VCEP v3.2.0. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.

Recorded applied criteria

The applied criteria and their strengths are shown as assessed under the stated framework.

Pathogenic evidence criteria: 2 Benign evidence criteria: 0
Pathogenic criteria applied · 2
PVS1Very strong
PVS1 · very strong

NM_000314.8:c.324_354del is a 31 bp frameshift deletion in exon 5, predicted to result in a premature termination codon at position 123 (p.Asp109LeufsTer15). Per the PTEN VCEP PVS1 decision tree, the variant is a frameshift predicted to undergo nonsense-mediated decay with the stop codon occurring at or 5' to p.D375 (c.1121) in the biologically-relevant transcript NM_000314.8, warranting PVS1 at very strong strength.

PM2Supporting
PM2 · supporting

This variant is absent from gnomAD v2.1 (exomes), gnomAD v4.1 (exomes/genomes), and gnomAD-Canada v1.0, meeting the PTEN VCEP PM2_Supporting threshold of <0.00001 (0.001%) allele frequency.

Benign criteria applied · 0

No benign criterion marked as applied in the recorded assessment.

Recorded classification: Likely pathogenic

Richards et.al., 2015 - Combining rules v3.2.0 criteria-combination framework: matched Rule20 (1 Pathogenic.Very Strong + 1 Pathogenic.Supporting) with applied criteria: PVS1 very strong, PM2 supporting; maps to Likely Pathogenic.

02The sources

Evidence at a glance

Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.

SpliceAI score
0.030 maximum delta

Recorded SpliceAI maximum delta score: 0.030. Refer to the recorded PP3/BP4 rationale for interpretation.

No listed criterion applied SpliceAI ↗
ClinVar submissions
Not recorded

A ClinVar laboratory submission summary was not recorded.

Context only ClinVar ↗
Functional evidence
Statement recorded

OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.

No listed criterion applied OncoKB ↗
COSMIC
Cancer Hotspots
Somatic evidence
No matching record reported

This variant has not previously been reported in somatic cancers (COSMIC).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.

Context only
COSMIC ↗Cancer Hotspots ↗
For specialists

Technical detail

ACMG/AMP criteria under ClinGen PTEN VCEP v3.2.0, with the data and sources behind each one.

28 criteria with recorded statuses: 2 met · 13 not met · 0 not assessed · 13 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.

Pathogenic
PVS1PS1PS2PS3PS4PM1PM2PM4PM5PM6PP1PP2PP3PP4PP5PS5
Benign
BA1BS1BS2BS3BS4BP1BP2BP3BP4BP5BP6BP7
Met Not met Not assessed Not applicable

NM_000314.8:c.324_354del is a 31 bp frameshift deletion in exon 5 of PTEN, predicted to result in a premature termination codon (p.Asp109LeufsTer15) with nonsense-mediated decay. Per the PTEN VCEP PVS1 decision tree, this variant meets PVS1 at very strong strength as the frameshift is predicted to undergo NMD with the stop codon occurring at or 5' to p.D375 (c.1121) in the biologically-relevant transcript NM_000314.8.

The variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada, meeting PM2_Supporting per the PTEN VCEP threshold of <0.00001 (0.001%) allele frequency.

Based on the PTEN VCEP combination rules (Rule1), the presence of one very strong pathogenic criterion (PVS1) is sufficient for a Pathogenic classification.

Met · 2

PVS1 Very strongNM_000314.8:c.324_354del is a 31 bp frameshift deletion in exon 5, predicted to result in a premature termination codon at position 123 (p.Asp109LeufsTer15). Per the PTEN VCEP PVS1 decision tree, the variant is a frameshift predicted to undergo nonsense-mediated decay with the stop codon occurring at or 5' to p.D375 (c.1121) in the biologically-relevant transcript NM_000314.8, warranting PVS1 at very strong strength. Details ▾Hide ▴
Evidence considered
  • Frameshift deletion at c.324 in exon 5
  • Predicted NMD with termination at codon 123
  • 5' to p.D375 (c.1121) threshold
  • PTEN loss of function is an established disease mechanism per VCEP
  • Transcript NM_000314.8 is biologically relevant (MANE Select)
Sources
vcep_pvs1_decisiontree_ptencspec ↗pvs1_gene_contextpvs1_variant_assessment
PM2 SupportingThis variant is absent from gnomAD v2.1 (exomes), gnomAD v4.1 (exomes/genomes), and gnomAD-Canada v1.0, meeting the PTEN VCEP PM2_Supporting threshold of <0.00001 (0.001%) allele frequency. Details ▾Hide ▴
Evidence considered
  • Absent from gnomAD v2.1
  • Absent from gnomAD v4.1
  • Absent from gnomAD-Canada v1.0
Sources
gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗cspec ↗

Not met · 13 · evaluated, threshold not reached

PS2 No de novo observation reported for this variant in ClinVar, published literature, or case-level data. Details ▾Hide ▴
Still missing
  • No de novo testing data available for this variant.
PS3 No variant-specific functional assay data available. The PTEN VCEP PS3 rules specify splicing assay evidence (PS3_Strong), phosphatase activity per Mighell et al. 2018 (PS3_Moderate, missense only), or activity <50% of wild-type (PS3_Supporting). This frameshift variant is not represented in the Mighell et al. missense saturation mutagenesis dataset (mmc2.xlsx), and no RNA/mini-gene splicing assay has been reported for this variant. Details ▾Hide ▴
Still missing
  • No variant-specific functional data identified in curated sources.
PS4 No proband or case-control data available for this variant. The variant is absent from ClinVar and no published case observations were identified. PS4 per PTEN VCEP requires probands with a specificity score or a significantly increased prevalence in affected individuals. Details ▾Hide ▴
Still missing
  • No proband counts or case-control data available.
PM1 The PTEN VCEP defines PM1-applicable catalytic motifs as residues 90-94 (WPD loop), 123-130 (P-loop), and 166-168 (TI-loop) (NP_000305.3). The deletion begins at codon 109, which lies outside these specified motifs. Details ▾Hide ▴
Evidence considered
  • Variant disrupts codon 109
  • catalytic motifs are residues 90-94
  • 123-130
  • 166-168 per PTEN VCEP
Sources
cspec ↗
PM6 No assumed or confirmed de novo observations have been reported for this variant in any source. Details ▾Hide ▴
Still missing
  • No de novo observations available.
PP1 No co-segregation data available for this variant in any family. Details ▾Hide ▴
Still missing
  • No family segregation data available.
BA1 The variant is absent from gnomAD populations; does not meet the PTEN VCEP BA1 threshold of filtering allele frequency >0.00056 (0.056%). Details ▾Hide ▴
Evidence considered
  • Absent from gnomAD v2.1
  • v4.1
  • and gnomAD-Canada
Sources
gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗
BS1 The variant is absent from gnomAD populations; does not meet the PTEN VCEP BS1 threshold (filtering allele frequency 0.000043-0.00056 for BS1_Strong or 0.0000043-0.000043 for BS1_Supporting). Details ▾Hide ▴
Evidence considered
  • Absent from gnomAD v2.1
  • v4.1
  • and gnomAD-Canada
Sources
gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗
BS2 No observation of this variant in the homozygous state in a healthy or PHTS-unaffected individual has been reported. Details ▾Hide ▴
Evidence considered
  • No homozygous observations in gnomAD
Still missing
  • No homozygous genotype data available.
Sources
gnomad_v2 ↗gnomad_v4 ↗
BS3 No well-established functional studies demonstrating no damaging effect are available for this variant. The PTEN VCEP BS3 rules specify splicing assays for intronic/synonymous variants or phosphatase activity >0 per Mighell et al. (missense only). This frameshift variant has no applicable functional benign evidence. Details ▾Hide ▴
Still missing
  • No variant-specific benign functional data available.
BS4 No segregation data demonstrating lack of segregation in affected family members are available for this variant. Details ▾Hide ▴
Still missing
  • No family segregation data available.
BP2 No observation of this variant in trans with a pathogenic/likely pathogenic PTEN variant, and no observations in cis or phase-unknown with different P/LP PTEN variants. Details ▾Hide ▴
Still missing
  • No phase data available.
BP5 No observation of this variant in a case with an alternate molecular basis for disease. Per PTEN VCEP, at least two such cases are required. Details ▾Hide ▴
Still missing
  • No cases with alternate molecular basis identified.
Not applicable · 13· recorded as not applicable Show reasons ▾Hide reasons ▴
PS1 N/APS1 requires same amino acid change as a previously established pathogenic variant. This is a frameshift deletion producing a truncated protein, not a defined amino acid substitution comparable to an established pathogenic missense change. Details ▾Hide ▴

No further detail was recorded.

PM4 N/APer PTEN VCEP, PM4 applies to in-frame deletions/insertions impacting at least one catalytic motif residue, or to variants causing protein extension. This is an out-of-frame (frameshift) deletion. Details ▾Hide ▴

No further detail was recorded.

PM5 N/APM5 requires a missense change at a residue where a different pathogenic missense change has been established. This is a 31 bp frameshift deletion, not a missense variant. Details ▾Hide ▴

No further detail was recorded.

PP2 N/APP2 is specific to missense variants in a gene with a low rate of benign missense variation. This is a frameshift deletion. Details ▾Hide ▴

No further detail was recorded.

PP3 N/APP3 per PTEN VCEP applies to splice-altering variants (SpliceAI + VarSeak concordance) or missense variants (REVEL >0.7). This is a frameshift deletion with SpliceAI max delta score 0.03 (no significant splice impact) and no applicable REVEL score. Details ▾Hide ▴
Evidence considered
  • SpliceAI max delta score = 0.03
  • no significant splice impact predicted
Sources
spliceai ↗
PP4 VCEPNot applicable per PTEN VCEP; phenotype specificity has been incorporated into the PS4 rule specifications. Details ▾Hide ▴
Sources
cspec ↗
PP5 VCEPNot applicable per PTEN VCEP; this criterion is not for use as recommended by the ClinGen Sequence Variant Interpretation VCEP Review Committee. Details ▾Hide ▴
Sources
cspec ↗
BP1 VCEPNot applicable per PTEN VCEP; this rule (missense variant in gene where primarily truncating variants cause disease) is not applicable to PTEN. Details ▾Hide ▴
Sources
cspec ↗
BP3 VCEPNot applicable per PTEN VCEP; this rule (in-frame deletions/insertions in a repetitive region without known function) is not applicable to PTEN. Details ▾Hide ▴
Sources
cspec ↗
BP4 N/ABP4 per PTEN VCEP is specified for synonymous or intronic variants where SpliceAI and VarSeak predict no splicing impact. This is a coding frameshift deletion and falls outside the intended scope of this criterion. Details ▾Hide ▴

No further detail was recorded.

BP6 VCEPNot applicable per PTEN VCEP; this criterion is not for use as recommended by the ClinGen Sequence Variant Interpretation VCEP Review Committee. Details ▾Hide ▴
Sources
cspec ↗
BP7 N/ABP7 applies to synonymous or intronic variants at or beyond +7/-21 with no predicted splice impact. This is a coding frameshift deletion. Details ▾Hide ▴

No further detail was recorded.

PS5 N/APS5 is not a defined criterion within the ClinGen PTEN Expert Panel Specifications v3.2.0; the VCEP explicitly designates PP5 as Not Applicable for this VCEP, obviating the use of reputable source classifications. Details ▾Hide ▴

No further detail was recorded.

Identifiers

Gene
PTEN
Transcript
NM_000314.8
Coding (HGVS c.)
NM_000314.8:c.324_354del
Protein (HGVS p.)
NP_000305.3:p.(Asp109LeufsTer15)
GRCh38
chr10:87933081 CTTGACCAATGGCTAAGTGAAGATGACAATCA>C
GRCh37
chr10:89692838 CTTGACCAATGGCTAAGTGAAGATGACAATCA>C

Gene diagram

Every interpreted variant in PTEN, mapped onto the exon structure of NM_000314.8. Select a row to find it on the plot.

PTENNM_000314.8
Fetching transcript structure from UCSC…
gnomAD v4.1 Allele count data not recorded
gnomAD v2.1 Allele count data not recorded
gnomAD-Canada v1.0 Allele count data not recorded

Statements

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

SpliceAI and Pangolin

SpliceAI acceptor lossat -86 bp
0.020
SpliceAI acceptor gainat +120 bp
0.030
SpliceAI donor lossat +170 bp
0.000
SpliceAI donor gainat -165 bp
0.000
Pangolin splice lossmagnitude shown
-0.080
Pangolin splice gain
0.020

Other predictors

REVEL
Not available
BayesDel
Not available

How the predictions were used

PP3 N/APP3 per PTEN VCEP applies to splice-altering variants (SpliceAI + VarSeak concordance) or missense variants (REVEL >0.7). This is a frameshift deletion with SpliceAI max delta score 0.03 (no significant splice impact) and no applicable REVEL score. Details ▾Hide ▴
Evidence considered
  • SpliceAI max delta score = 0.03
  • no significant splice impact predicted
Sources
spliceai ↗
BP4 N/ABP4 per PTEN VCEP is specified for synonymous or intronic variants where SpliceAI and VarSeak predict no splicing impact. This is a coding frameshift deletion and falls outside the intended scope of this criterion. Details ▾Hide ▴

No further detail was recorded.

BP7 N/ABP7 applies to synonymous or intronic variants at or beyond +7/-21 with no predicted splice impact. This is a coding frameshift deletion. Details ▾Hide ▴

No further detail was recorded.

Statement

In silico

SpliceAI predicts no significant splice impact for this variant (max delta score = 0.03).

2 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata. None of the listed paper records explicitly indicates that the variant is named.

Recorded publications

  • PTEN: life as a tumor suppressor.
    Review article summarizing PTEN gene discovery, mutational spectrum in sporadic cancers and hamartoma syndromes, and PI3K/Akt signaling pathway function. NM_000314.8:c.324_354del was not identified in this paper.
    Does not name this variant
    PMID 11237521 ↗
  • Essential role for nuclear PTEN in maintaining chromosomal integrity.
    Research article demonstrating that PTEN localizes to centromeres and maintains chromosomal integrity through physical interaction with CENP-C and regulation of Rad51-mediated DNA repair. Studies PTEN-null MEFs, PTEN.C124S, PTEN.R189X, PTEN.R233X, and Cowden syndrome IVS6+1 G>T lymphoblastoid cells. NM_000314.8:c.324_354del was not identified in this paper.
    Does not name this variant
    PMID 17218262 ↗

Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.

gnomAD v4.1 Captured gnomAD v4.1 source record Open source ↗
gnomAD v2.1 Captured gnomAD v2.1 source record Open source ↗
SpliceAI Lookup Recorded maximum delta 0.030 Open source ↗
ClinVar Captured ClinVar source record Open source ↗
COSMIC Captured COSMIC source record Open source ↗
Cancer hotspots Captured Cancer Hotspots source record Open source ↗
OncoKB Captured OncoKB source record Open source ↗
ClinGen CSpec Captured ClinGen CSpec source record Open source ↗

All source links

Statements for reports

The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

ClinVar

This variant is absent from ClinVar.

In silico

SpliceAI predicts no significant splice impact for this variant (max delta score = 0.03).

Functional

OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.

Somatic

This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.