0%
STK11c.539_571delinsTGGTAGGGTGGCACCTCUncertain significance
Print report
Variant interpretation report

STK11 c.539_571delinsTGGTAGGGTGGCACCTC, p.(Gly180ValfsTer102)

NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC NP_000446.1:p.(Gly180ValfsTer102) View identifiers
Classification
Uncertain significance

Variant description:

No variant summary was recorded for this case.

Five-step scale from benign to pathogenic. This variant is uncertain. Select a step to read what it means.

Uncertain.The recorded classification is uncertain significance.

In plain language

Gene-level background from the recorded interpretation.

About STK11

No gene-level summary was recorded for this case.

LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
01The reasoning

How it was classified

The recorded framework is Not recorded. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.

Recorded applied criteria

The applied criteria and their strengths are shown as assessed under the stated framework.

Pathogenic evidence criteria: 2 Benign evidence criteria: 0
Pathogenic criteria applied · 2
PVS1Very strong
PVS1 · very strong

Frameshift variant NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC predicts p.(Gly180ValfsTer102), introducing a premature termination codon at residue 281 within exon 4 of 9 coding exons. Loss of function is a well-established disease mechanism for STK11 in Peutz-Jeghers syndrome. The predicted transcript is expected to undergo nonsense-mediated decay per the ClinGen SVI PVS1 decision framework (PMC6185798).

PM2Supporting
PM2 · supporting

NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada, indicating it is not observed in large population cohorts.

Benign criteria applied · 0

No benign criterion marked as applied in the recorded assessment.

Recorded classification: Uncertain significance

gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PVS1 very strong, PM2 supporting; combination = 1 very strong + 1 supporting, which maps to VUS.

02The sources

Evidence at a glance

Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.

SpliceAI score
0.470 maximum delta

Recorded SpliceAI maximum delta score: 0.470. Refer to the recorded PP3/BP4 rationale for interpretation.

No listed criterion applied SpliceAI ↗
ClinVar submissions
Not recorded

A ClinVar laboratory submission summary was not recorded.

Context only ClinVar ↗
Functional evidence
Statement recorded

OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.

No listed criterion applied OncoKB ↗
COSMIC
Cancer Hotspots
Somatic evidence
No matching record reported

This variant has not previously been reported in somatic cancers (COSMIC).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.

Context only
COSMIC ↗Cancer Hotspots ↗
For specialists

Technical detail

ACMG/AMP criteria under Not recorded, with the data and sources behind each one.

29 criteria with recorded statuses: 2 met · 17 not met · 0 not assessed · 10 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.

Pathogenic
PVS1PS1PS2PS3PS4PM1PM2PM3PM4PM5PM6PP1PP2PP3PP4PP5PS5
Benign
BA1BS1BS2BS3BS4BP1BP2BP3BP4BP5BP6BP7
Met Not met Not assessed Not applicable

NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC is a frameshift variant predicted to cause p.(Gly180ValfsTer102) with a premature termination codon at residue 281, expected to trigger nonsense-mediated decay. Loss of function is an established disease mechanism for STK11 in Peutz-Jeghers syndrome.

The variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada population databases, supporting its rarity in the general population.

The variant is absent from ClinVar and has not been reported in affected individuals, in somatic cancer databases (COSMIC), or in any of the five gene-level functional publications reviewed.

No variant-specific functional studies, segregation data, de novo observations, or case-control data were identified. Five publications retrieved via OncoKB discuss STK11 function at the gene level but none include NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC.

Under the ClinGen SVI PVS1 decision framework (PMC6185798), a frameshift variant upstream of the last exon in a gene with an established loss-of-function disease mechanism qualifies for PVS1 at full strength.

Met · 2

PVS1 Very strongFrameshift variant NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC predicts p.(Gly180ValfsTer102), introducing a premature termination codon at residue 281 within exon 4 of 9 coding exons. Loss of function is a well-established disease mechanism for STK11 in Peutz-Jeghers syndrome. The predicted transcript is expected to undergo nonsense-mediated decay per the ClinGen SVI PVS1 decision framework (PMC6185798). Details ▾Hide ▴
Evidence considered
  • Frameshift variant in exon 4 of 9 coding exons
  • Loss of function is established disease mechanism for STK11 (Peutz-Jeghers syndrome)
  • PTC at residue 281 predicted to trigger nonsense-mediated decay
  • ClinGen SVI PVS1 framework (PMC6185798) supports full-strength PVS1 for frameshift variants in LoF genes
Sources
pvs1_generic_framework ↗pvs1_gene_contextpvs1_variant_assessment
PM2 SupportingNM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada, indicating it is not observed in large population cohorts. Details ▾Hide ▴
Evidence considered
  • Absent from gnomAD v2.1 (0 alleles)
  • Absent from gnomAD v4.1 (0 alleles)
  • Absent from gnomAD-Canada v1.0 (0 alleles)
Sources
gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗

Not met · 17 · evaluated, threshold not reached

PS2 No de novo observation has been reported for NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC in any reviewed publication or database. Details ▾Hide ▴
Still missing
  • No de novo testing or family studies available
PS3 No variant-specific functional studies were identified for NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC. Five publications retrieved via OncoKB discuss STK11/LKB1 function at the gene level but none include this specific variant in functional assays. Details ▾Hide ▴
Still missing
  • No variant-specific functional data available
PS4 The variant is absent from ClinVar and has not been observed in affected individuals in any reviewed source. No case-control or statistical enrichment data are available. Details ▾Hide ▴
Evidence considered
  • Absent from ClinVar
  • no affected individuals reported
Still missing
  • No case-control or cohort data available
Sources
clinvar ↗
PM6 No de novo observation has been reported for this variant in any reviewed publication or database. PMID:22118009 reports a different STK11 de novo variant (c.698_699insG), not NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC. Details ▾Hide ▴
Still missing
  • No de novo testing data available
PP1 No segregation data are available for this variant. No family studies have been reported. Details ▾Hide ▴
Still missing
  • No segregation or family data available
PP3 In silico tools applicable to indels are limited. SpliceAI predicts a moderate splice impact (max delta score 0.47), but REVEL and BayesDel are not applicable to this variant type. Multiple lines of computational evidence supporting a deleterious effect are not available. Details ▾Hide ▴
Evidence considered
  • SpliceAI max delta score 0.47 (DS_DG)
  • insufficient alone to meet PP3
Still missing
  • No multiple lines of in silico evidence available for this indel
Sources
spliceai ↗
PP4 No phenotype or family history data specific to this variant are available. The variant is absent from ClinVar and has not been reported in any affected individual. Details ▾Hide ▴
Still missing
  • No phenotype data available
PP5 The variant is absent from ClinVar. No reputable source has classified this variant as pathogenic. Details ▾Hide ▴
Evidence considered
  • Absent from ClinVar with no classification from any submitter
Sources
clinvar ↗
BA1 Allele frequency is 0% across all gnomAD datasets, well below the BA1 threshold of >1%. Details ▾Hide ▴
Evidence considered
  • AF = 0.00 in gnomAD v2.1
  • v4.1
  • and Canada
Sources
gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗
BS1 Allele frequency is 0% across all gnomAD datasets, well below the BS1 threshold of >0.3%. Details ▾Hide ▴
Evidence considered
  • AF = 0.00 in gnomAD v2.1
  • v4.1
  • and Canada
Sources
gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗
BS2 The variant has not been observed in any healthy adult control population. It is absent from all gnomAD datasets. Details ▾Hide ▴
Evidence considered
  • Absent from all population databases
Sources
gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗
BS3 No variant-specific functional studies were identified demonstrating no deleterious effect for NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC. Five gene-level functional publications were reviewed but none tested this variant. Details ▾Hide ▴
Still missing
  • No variant-specific functional data available
BS4 No segregation or non-segregation data are available. No family studies involving this variant have been reported. Details ▾Hide ▴
Still missing
  • No family or segregation data available
BP2 No observation of this variant in trans with a known pathogenic STK11 variant has been reported. Details ▾Hide ▴
Still missing
  • No data on trans configuration with pathogenic variants
BP4 Multiple lines of computational evidence do not suggest a benign effect. SpliceAI predicts a moderate splice alteration (max delta 0.47). REVEL and BayesDel are not applicable to this variant type, so comprehensive benign computational consensus cannot be established. Details ▾Hide ▴
Evidence considered
  • SpliceAI max delta 0.47 does not support benign effect
Sources
spliceai ↗
BP5 No observation of this variant in a case where an alternate molecular basis for disease has been identified. Details ▾Hide ▴
Still missing
  • No data on alternate molecular basis
BP6 No reputable source has classified this variant as benign. The variant is absent from ClinVar entirely. Details ▾Hide ▴
Evidence considered
  • Absent from ClinVar
  • no benign classification available
Sources
clinvar ↗
Not applicable · 10· recorded as not applicable Show reasons ▾Hide reasons ▴
PS1 N/APS1 applies to same amino acid change as an established pathogenic variant. This variant is a frameshift, not a missense substitution. Details ▾Hide ▴

No further detail was recorded.

PM1 N/APM1 applies to missense variants in a mutational hotspot or critical functional domain without benign variation. This variant is a frameshift; the loss-of-function effect is already fully captured by PVS1, and applying PM1 would constitute double-counting. Details ▾Hide ▴

No further detail was recorded.

PM3 N/ATrivially not applicable per case instructions. Details ▾Hide ▴

No further detail was recorded.

PM4 N/APM4 applies to in-frame deletions/insertions or stop-loss variants. This variant is a frameshift (out-of-frame delins), which is addressed by PVS1. Details ▾Hide ▴

No further detail was recorded.

PM5 N/APM5 applies to novel missense variants at a residue where a different pathogenic missense has been established. This variant is a frameshift; no same-residue missense comparator exists. Automated PM5 candidate harvesting confirmed no eligible comparators. Details ▾Hide ▴
Evidence considered
  • No same-residue missense comparators found
Sources
pm5_candidates
PP2 N/APP2 applies to missense variants in genes with a low rate of benign missense variation. This variant is a frameshift, not a missense. Details ▾Hide ▴

No further detail was recorded.

BP1 N/ABP1 applies to missense variants in genes where primarily truncating variants cause disease. This variant is itself a truncating (frameshift) variant. Details ▾Hide ▴

No further detail was recorded.

BP3 N/ABP3 applies to in-frame deletions or insertions in a repetitive region without known function. This variant is an out-of-frame (frameshift) alteration. Details ▾Hide ▴

No further detail was recorded.

BP7 N/ABP7 applies to synonymous variants with no predicted splice impact. This variant is a frameshift alteration. Details ▾Hide ▴

No further detail was recorded.

PS5 N/APS5 applies to missense variants at a residue where a different pathogenic missense has been established. This variant is a frameshift. Details ▾Hide ▴

No further detail was recorded.

Identifiers

Gene
STK11
Transcript
NM_000455.4
Coding (HGVS c.)
NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC
Protein (HGVS p.)
NP_000446.1:p.(Gly180ValfsTer102)
GRCh38
chr19:1220447 GGAACCTGCTGCTCACCACCGGTGGCACCCTCA>TGGTAGGGTGGCACCTC
GRCh37
chr19:1220446 GGAACCTGCTGCTCACCACCGGTGGCACCCTCA>TGGTAGGGTGGCACCTC

Gene diagram

Every interpreted variant in STK11, mapped onto the exon structure of NM_000455.4. Select a row to find it on the plot.

STK11NM_000455.4
Fetching transcript structure from UCSC…
gnomAD v4.1 Allele count data not recorded
gnomAD v2.1 Allele count data not recorded
gnomAD-Canada v1.0 Allele count data not recorded

Statements

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

SpliceAI and Pangolin

SpliceAI acceptor lossat +197 bp
0.060
SpliceAI acceptor gainat -425 bp
0.030
SpliceAI donor lossat +58 bp
0.140
SpliceAI donor gainat +0 bp
0.470

Other predictors

REVEL
Not available
BayesDel
Not available

How the predictions were used

PP3 In silico tools applicable to indels are limited. SpliceAI predicts a moderate splice impact (max delta score 0.47), but REVEL and BayesDel are not applicable to this variant type. Multiple lines of computational evidence supporting a deleterious effect are not available. Details ▾Hide ▴
Evidence considered
  • SpliceAI max delta score 0.47 (DS_DG)
  • insufficient alone to meet PP3
Still missing
  • No multiple lines of in silico evidence available for this indel
Sources
spliceai ↗
BP4 Multiple lines of computational evidence do not suggest a benign effect. SpliceAI predicts a moderate splice alteration (max delta 0.47). REVEL and BayesDel are not applicable to this variant type, so comprehensive benign computational consensus cannot be established. Details ▾Hide ▴
Evidence considered
  • SpliceAI max delta 0.47 does not support benign effect
Sources
spliceai ↗
BP7 N/ABP7 applies to synonymous variants with no predicted splice impact. This variant is a frameshift alteration. Details ▾Hide ▴

No further detail was recorded.

Statement

In silico

SpliceAI predicts possible splice impact for this variant (max delta score = 0.47).

5 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata. None of the listed paper records explicitly indicates that the variant is named.

Recorded publications

  • Somatic LKB1 mutations promote cervical cancer progression.
    Describes somatic LKB1 mutations in cervical cancer progression. NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC was not identified in the full text of this publication.
    Does not name this variant
    PMID 19340305 ↗
  • Structure of the LKB1-STRAD-MO25 complex reveals an allosteric mechanism of kinase activation.
    Reports the crystal structure of the LKB1-STRAD-MO25 complex and allosteric mechanism of kinase activation. NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC was not identified in the abstract.
    Does not name this variant
    PMID 19892943 ↗
  • The role of LKB1 in lung cancer.
    Reviews the role of LKB1 in lung cancer, including mutational landscape and functional consequences. NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC was not identified in the abstract.
    Does not name this variant
    PMID 21516316 ↗
  • STK11 domain XI mutations: candidate genetic drivers leading to the development of dysplastic polyps in Peutz-Jeghers syndrome.
    Investigates STK11 domain XI mutations as candidate drivers of dysplastic polyps in Peutz-Jeghers syndrome. NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC is in exon 4 (kinase domain), not domain XI, and was not identified in the abstract.
    Does not name this variant
    PMID 24652667 ↗
  • Comprehensive molecular profiling of lung adenocarcinoma.
    Reports comprehensive molecular profiling of 230 lung adenocarcinomas including STK11 mutations. NM_000455.4:c.539_571delinsTGGTAGGGTGGCACCTC was not identified in the abstract.
    Does not name this variant
    PMID 25079552 ↗

Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.

gnomAD v4.1 Captured gnomAD v4.1 source record Open source ↗
gnomAD v2.1 Captured gnomAD v2.1 source record Open source ↗
SpliceAI Lookup Recorded maximum delta 0.470 Open source ↗
ClinVar Captured ClinVar source record Open source ↗
COSMIC Captured COSMIC source record Open source ↗
Cancer hotspots Captured Cancer Hotspots source record Open source ↗
OncoKB Captured OncoKB source record Open source ↗

All source links

Statements for reports

The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

ClinVar

This variant is absent from ClinVar.

In silico

SpliceAI predicts possible splice impact for this variant (max delta score = 0.47).

Functional

OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.

Somatic

This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.