About CUX1
No gene-level summary was recorded for this case.
Previous versions
Variant interpretation report
CUX1 c.1657_1716+4dup, p.?
Classification
Uncertain significance
Variant description:
No variant summary was recorded for this case.
Five-step scale from benign to pathogenic. This variant is uncertain. Select a step to read what it means.
Uncertain.The recorded classification is uncertain significance.
In plain language
Gene-level background from the recorded interpretation.
Words with a dotted underline have a short definition. Hover or tap them.
LYFE Sciences is an AI system, and it can make mistakes.
Criteria may be applied incorrectly, sources may be misread, and a
confident-looking classification can still be wrong.
Double-check every criterion and its underlying evidence
before relying on any call.
01The reasoning
How it was classified
The recorded framework is Not recorded. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.
Recorded applied criteria
The applied criteria and their strengths are shown as assessed under the stated framework.
Pathogenic evidence criteria: 1
Benign evidence criteria: 0
Pathogenic criteria applied · 1
PM2Supporting
PM2 · supporting
This variant is absent from gnomAD v2.1 and gnomAD v4.1, which is below the generic rarity threshold of 0.1% for PM2 support and is consistent with a rare variant.
Benign criteria applied · 0
No benign criterion marked as applied in the recorded assessment.
Recorded classification: Uncertain significance
gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PM2 supporting; combination = 1 supporting, which maps to VUS.
02The sources
Evidence at a glance
Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.
gnomAD v4.1
gnomAD v2.1
Population frequency
Not recorded
gnomAD v4.1 allele counts were not recorded for this variant.
gnomAD v2.1
Absent from gnomAD v2.1.
No screenshot for this evidence
Computational predictions
Not recorded
No SpliceAI or REVEL score is recorded in the fields used for this tile.
No listed criterion applied
ClinVar submissions
Not recorded
A ClinVar laboratory submission summary was not recorded.
Context only
ClinVar ↗
No screenshot for this evidence
Functional evidence
Not recorded
No standalone functional evidence summary is recorded in evidence_summary.functional.
No listed criterion applied
OncoKB ↗
Somatic evidence
Not assessed
No COSMIC evidence statement is recorded in this case.
Context only
COSMIC ↗
For specialists
Technical detail
ACMG/AMP criteria under Not recorded, with the data and sources behind each one.
28 criteria with recorded statuses: 1 met · 4 not met · 20 not assessed · 3 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.
Met
Not met
Not assessed
Not applicable
The CUX1 c.1657_1716+4dup (NP_001189473.1:p.?) variant has not been reported in ClinVar.
This variant is absent from gnomAD v2.1 and gnomAD v4.1, which supports rarity in population databases.
Germline loss of function is an established disease mechanism for CUX1, but this duplication does not fall into the generic PVS1 default null-variant categories based on the available variant-level assessment.
SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.05.
No criteria match.
Met · 1
PM2 SupportingThis variant is absent from gnomAD v2.1 and gnomAD v4.1, which is below the generic rarity threshold of 0.1% for PM2 support and is consistent with a rare variant. Details ▾Hide ▴
Not met · 4 · evaluated, threshold not reached
PVS1 Germline loss of function is an established disease mechanism for CUX1, but this duplication does not fall into the generic PVS1 default null-variant categories of nonsense, frameshift, or canonical +/-1,2 splice variants, so PVS1 is not applied. Details ▾Hide ▴
Evidence considered
- CUX1 loss of function supported as a germline disease mechanism in gene-level context.
- Variant scaffold classifies NM_001202544.1:c.1657_1716+4dup outside the default generic PVS1 null-variant buckets.
Still missing
- RNA or splicing studies for this exact variant were not identified.
- The transcript-level consequence of this exon-intron duplication remains uncertain.
Sources
PP3 Available computational evidence does not support a damaging splicing effect because SpliceAI shows a maximum delta score of 0.05, which is below commonly used splice-impact thresholds; REVEL and BayesDel were not available because this is not an SNV. Details ▾Hide ▴
Evidence considered
- SpliceAI DS_AG 0.01
- DS_AL 0.01
- DS_DG 0.05
- DS_DL 0.01
- max delta 0.05.
- REVEL and BayesDel were skipped for this non-SNV variant.
Still missing
- No additional validated computational predictors for this non-SNV event were available.
Sources
BA1 This variant is absent from gnomAD v2.1 and v4.1 and therefore does not meet the stand-alone benign frequency threshold of 1%. Details ▾Hide ▴
BS1 This variant is absent from gnomAD v2.1 and v4.1 and therefore does not exceed the benign frequency threshold of 0.3%. Details ▾Hide ▴
Not assessed · 20 · no assessment recorded
PS1 No evidence was identified showing that this variant results in the same amino acid change as a previously established pathogenic variant. Details ▾Hide ▴
Evidence considered
- Protein consequence listed as NP_001189473.1:p.?.
Still missing
- No pathogenic comparator variant producing the same protein consequence was identified.
- The protein consequence remains unresolved as p.?.
PS2 No confirmed de novo occurrence data were identified for this variant. Details ▾Hide ▴
Evidence considered
- ClinVar search returned no exact record.
Still missing
- No trio or parental testing report was identified.
- No case-level report with confirmed maternity and paternity was found.
Sources
PS3 No well-established functional studies were identified for this variant. Details ▾Hide ▴
Evidence considered
- No publications were retrieved from the evidence sources for this exact variant.
Still missing
- No RNA
- minigene
- or protein-function assay for this exact variant was identified.
Sources
PS4 No evidence was identified showing that this variant is enriched in affected individuals compared with controls. Details ▾Hide ▴
Evidence considered
- Variant absent from ClinVar.
- Variant absent from gnomAD v2.1 and v4.1.
Still missing
- No case series or burden data for this exact variant were identified.
- ClinVar contained no submissions for this variant.
Sources
PM1 Available evidence does not establish that this variant lies in a mutational hotspot or a well-studied critical region without benign variation. Details ▾Hide ▴
Still missing
- No hotspot or critical-region evidence was retrieved in the available sources.
PM3 No data were identified showing this variant in trans with another pathogenic variant. Details ▾Hide ▴
Evidence considered
- ClinVar contained no case-level submissions for this variant.
Still missing
- No phasing or biallelic case data were identified.
Sources
PM4 This duplication extends from coding sequence into intronic sequence, and the resulting protein consequence remains uncertain, so protein-length change evidence cannot be applied from the available data. Details ▾Hide ▴
Evidence considered
- Protein consequence reported as p.?.
- Variant scaffold categorized this event outside default null-variant buckets.
Still missing
- The transcript and protein consequence need direct characterization.
Sources
pvs1_variant_assessment
PM5 No evidence was identified for a different pathogenic missense change at the same residue because the protein consequence of this variant is unresolved. Details ▾Hide ▴
Still missing
- No same-residue pathogenic comparator was identified.
- Protein consequence remains p.?.
PM6 No presumed de novo occurrence data were identified for this variant. Details ▾Hide ▴
Evidence considered
- ClinVar search returned no exact record.
Still missing
- No parental testing or case report describing inheritance was identified.
Sources
PP1 No segregation data were identified for this variant. Details ▾Hide ▴
Evidence considered
- ClinVar contained no submissions for this variant.
Still missing
- No family studies or pedigree data were found.
Sources
PP4 No phenotype information was provided to determine whether the observed clinical features are highly specific for a CUX1-related disorder. Details ▾Hide ▴
Still missing
- Phenotype details and clinical correlation were not available in the reviewed sources.
PP5 No reputable source classification was identified for this variant. Details ▾Hide ▴
Evidence considered
- Variant absent from ClinVar.
Still missing
- ClinVar contained no record for this variant.
Sources
BS2 No evidence was identified showing this variant in healthy adults for a disorder with expected penetrance at the relevant age. Details ▾Hide ▴
Evidence considered
- Variant absent from gnomAD v2.1 and v4.1.
Still missing
- No unaffected carrier data were identified.
Sources
BS3 No well-established functional studies were identified showing no damaging effect for this variant. Details ▾Hide ▴
Evidence considered
- No publications were retrieved from the evidence sources for this exact variant.
Still missing
- No benign RNA or protein-function assay for this exact variant was identified.
Sources
BS4 No non-segregation data were identified for this variant. Details ▾Hide ▴
Evidence considered
- ClinVar contained no submissions for this variant.
Still missing
- No family study showing lack of segregation was found.
Sources
BP2 No phasing data were identified to determine whether this variant occurs in trans with a pathogenic variant for a dominant disorder or in cis with another pathogenic variant. Details ▾Hide ▴
Evidence considered
- ClinVar contained no submissions for this variant.
Still missing
- No case-level genotype or phasing data were identified.
Sources
BP3 Available evidence does not show that this duplication is an in-frame event in a repetitive region without known function. Details ▾Hide ▴
Still missing
- The repeat context and final protein consequence were not established in the reviewed sources.
BP4 SpliceAI predicts no significant splice impact with a maximum delta score of 0.05, but this exon-intron duplication also alters coding sequence and the overall transcript and protein consequence remains uncertain, so benign computational evidence is not applied. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta score 0.05.
Still missing
- Direct transcript or protein consequence data are needed before applying benign computational evidence with confidence.
Sources
BP5 No alternate molecular explanation for disease was provided, so this criterion cannot be assessed from the available evidence. Details ▾Hide ▴
Still missing
- Clinical and broader genotype context were not available.
BP6 No reputable source reported this variant as benign or likely benign. Details ▾Hide ▴
Evidence considered
- Variant absent from ClinVar.
Still missing
- ClinVar contained no record for this variant.
Sources
Not applicable · 3· recorded as not applicable Show reasons ▾Hide reasons ▴
PP2 N/APP2 is a missense-specific criterion, and this variant is not an established missense change. Details ▾Hide ▴
Evidence considered
- Protein consequence reported as p.?.
BP1 N/ABP1 is a missense-specific criterion, and this variant is not an established missense change. Details ▾Hide ▴
Evidence considered
- Protein consequence reported as p.?.
BP7 N/ABP7 applies to synonymous or intronic variants without predicted splice impact, and this variant is a duplication that includes coding sequence. Details ▾Hide ▴
Evidence considered
- Variant described as c.1657_1716+4dup with coding sequence involvement.
- SpliceAI max delta score 0.05.
Sources
Identifiers
- Gene
- CUX1
- Transcript
- NM_001202544.1
- Coding (HGVS c.)
- NM_001202544.1:c.1657_1716+4dup
- Protein (HGVS p.)
- NP_001189473.1:p.?
- GRCh38
- chr7:102280060 G>GCTGCGGTACTCGTCCCAGTACGAGGAGCGCCTGGACCCCTTCTCCTCCTTCAGCAAGCGGGTTC
- GRCh37
- chr7:101923352 G>GCTGCGGTACTCGTCCCAGTACGAGGAGCGCCTGGACCCCTTCTCCTCCTTCAGCAAGCGGGTTC
Gene diagram
Every interpreted variant in CUX1, mapped onto the exon structure of NM_001202544.1. Select a row to find it on the plot.
CUX1NM_001202544.1
Fetching transcript structure from UCSC…
Exons
—
Transcript span
—
Strand
—
Variants mapped
—
Source
UCSC ncbiRefSeqCurated
All variants in CUX1
—
Select a row to find it on the plot; use the link to open its page.
| Protein | Location | Classification | Link |
|---|
gnomAD v4.1
Allele count data not recorded
gnomAD v2.1
Allele count data not recorded
Statements
gnomAD v4.1
Absent from gnomAD v4.1.
gnomAD v2.1
Absent from gnomAD v2.1.
Other predictors
- REVEL
- Not available
- BayesDel
- Not available
How the predictions were used
PP3 Available computational evidence does not support a damaging splicing effect because SpliceAI shows a maximum delta score of 0.05, which is below commonly used splice-impact thresholds; REVEL and BayesDel were not available because this is not an SNV. Details ▾Hide ▴
Evidence considered
- SpliceAI DS_AG 0.01
- DS_AL 0.01
- DS_DG 0.05
- DS_DL 0.01
- max delta 0.05.
- REVEL and BayesDel were skipped for this non-SNV variant.
Still missing
- No additional validated computational predictors for this non-SNV event were available.
Sources
BP4 SpliceAI predicts no significant splice impact with a maximum delta score of 0.05, but this exon-intron duplication also alters coding sequence and the overall transcript and protein consequence remains uncertain, so benign computational evidence is not applied. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta score 0.05.
Still missing
- Direct transcript or protein consequence data are needed before applying benign computational evidence with confidence.
Sources
BP7 N/ABP7 applies to synonymous or intronic variants without predicted splice impact, and this variant is a duplication that includes coding sequence. Details ▾Hide ▴
Evidence considered
- Variant described as c.1657_1716+4dup with coding sequence involvement.
- SpliceAI max delta score 0.05.
Sources
Statement
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.05).
0 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata.
Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.
gnomAD v4.1
Captured gnomAD v4.1 source record
Open source ↗
gnomAD v2.1
Captured gnomAD v2.1 source record
Open source ↗
SpliceAI Lookup
Captured SpliceAI source record
Open source ↗
ClinVar
Captured ClinVar source record
Open source ↗
COSMIC
Captured COSMIC source record
Open source ↗
All source links
- ClinVar ↗www.ncbi.nlm.nih.gov/clinvar/?term=NM_001202544.1%3Ac.1657_1716…
- gnomAD v2.1 ↗gnomad.broadinstitute.org/variant/7-101923352-G-GCTGCGGTACTCGTC…
- gnomAD v4.1 ↗gnomad.broadinstitute.org/variant/chr7-102280060-G-GCTGCGGTACTC…
- SpliceAI Lookup ↗spliceailookup.broadinstitute.org/#variant=NM_001202544.1%3Ac.1…
- OncoKB ↗www.oncokb.org/gene/CUX1/?
- COSMIC ↗cancer.sanger.ac.uk/cosmic/search?q=CUX1+c.1657_1716+4dup
Statements for reports
The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.
gnomAD v4.1
Absent from gnomAD v4.1.
gnomAD v2.1
Absent from gnomAD v2.1.
ClinVar
This variant is absent from ClinVar.
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.05).
Somatic
This variant has not previously been reported in somatic cancers (COSMIC).