0%
CDK6c.880_955delinsTCTGGCTGGGCGGCAGGTGGGAATCCAGGTTTTCTTTGCACCTTTCCUncertain significance
Print report
Variant interpretation report

CDK6 c.880_955delinsTCTGGCTGGGCGGCAGGTGGGAATCCAGGTTTTCTTTGCACCTTTCC, p.(Ala294SerfsTer31)

NM_001259.8:c.880_955delinsTCTGGCTGGGCGGCAGGTGGGAATCCAGGTTTTCTTTGCACCTTTCC NP_001250.1:p.(Ala294SerfsTer31) View identifiers
Classification
Uncertain significance

Variant description:

No variant summary was recorded for this case.

Five-step scale from benign to pathogenic. This variant is uncertain. Select a step to read what it means.

Uncertain.The recorded classification is uncertain significance.

In plain language

Gene-level background from the recorded interpretation.

About CDK6

No gene-level summary was recorded for this case.

LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
01The reasoning

How it was classified

The recorded framework is Not recorded. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.

Recorded applied criteria

The applied criteria and their strengths are shown as assessed under the stated framework.

Pathogenic evidence criteria: 2 Benign evidence criteria: 0
Pathogenic criteria applied · 2
PVS1Moderate
PVS1 · moderate

Frameshift variant NM_001259.8:c.880_955delins predicted to result in p.(Ala294SerfsTer31). CDK6 loss of function is an established germline disease mechanism. Under PMC6185798, the variant is in the last exon (8/8) and the premature termination codon at codon 325 is within 50 nucleotides of the final exon-exon junction, so nonsense-mediated decay is not predicted. The truncation removes the C-terminal portion of the kinase domain (residues 294-326) and replaces it with 31 novel amino acids, partially disrupting a well-characterized functional domain. Downgraded from very strong to moderate per PMC6185798 guidance for truncating variants in the last exon that affect a critical functional region but are not expected to undergo NMD.

PM2Moderate
PM2 · moderate

This variant is absent from gnomAD v2.1 (exomes), gnomAD v4.1 (exomes/genomes), and gnomAD-Canada v1.0 (HostSeq genomes). Under generic ACMG/AMP criteria, absence from large population databases supports PM2 at moderate strength (allele frequency below 0.1% threshold).

Benign criteria applied · 0

No benign criterion marked as applied in the recorded assessment.

Recorded classification: Uncertain significance

gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PVS1 moderate, PM2 moderate; combination = 2 moderate, which maps to VUS.

02The sources

Evidence at a glance

Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.

No screenshot for this evidence
Computational predictions
Not recorded

No SpliceAI or REVEL score is recorded in the fields used for this tile.

No listed criterion applied
ClinVar submissions
Not recorded

A ClinVar laboratory submission summary was not recorded.

Context only ClinVar ↗
Functional evidence
Statement recorded

OncoKB identified curated literature and non-variant-specific oncogenicity context for review; listed oncogenicity label: Unknown Oncogenic Effect.

No listed criterion applied OncoKB ↗
COSMIC
Cancer Hotspots
Somatic evidence
No matching record reported

This variant has not previously been reported in somatic cancers (COSMIC).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.

Context only
COSMIC ↗Cancer Hotspots ↗
For specialists

Technical detail

ACMG/AMP criteria under Not recorded, with the data and sources behind each one.

28 criteria with recorded statuses: 2 met · 5 not met · 11 not assessed · 10 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.

Pathogenic
PVS1PS1PS2PS3PS4PM1PM2PM4PM5PM6PP1PP2PP3PP4PP5PS5
Benign
BA1BS1BS2BS3BS4BP1BP2BP3BP4BP5BP6BP7
Met Not met Not assessed Not applicable

PVS1 at moderate strength: NM_001259.8:c.880_955delins is a frameshift variant predicted to result in p.(Ala294SerfsTer31), truncating the C-terminal kinase domain of CDK6. CDK6 loss of function is an established germline disease mechanism. Nonsense-mediated decay is not predicted because the variant is in the last exon (8/8) and the premature termination codon (codon 325) lies within 50 nucleotides of the final exon-exon junction. Under PMC6185798 guidance for truncating variants escaping NMD that affect a critical functional domain, PVS1 is downgraded to moderate.

PM2 at moderate strength: The variant is absent from gnomAD v2.1 (141,456 individuals), gnomAD v4.1 (807,162 individuals), and gnomAD-Canada v1.0 (HostSeq genomes). No population frequency data supports benign standing variation.

The variant is absent from ClinVar and COSMIC. No publications, functional data, or family segregation data were identified for this specific variant. Per the generic ACMG/AMP 2015 classification framework (PMID:25741868), PVS1 at moderate plus PM2 at moderate yields two moderate pathogenic criteria, which does not reach the threshold for Likely Pathogenic (requires ≥3 moderate or 1 strong + 1-2 moderate). This variant is classified as a Variant of Uncertain Significance (VUS).

Met · 2

PVS1 ModerateFrameshift variant NM_001259.8:c.880_955delins predicted to result in p.(Ala294SerfsTer31). CDK6 loss of function is an established germline disease mechanism. Under PMC6185798, the variant is in the last exon (8/8) and the premature termination codon at codon 325 is within 50 nucleotides of the final exon-exon junction, so nonsense-mediated decay is not predicted. The truncation removes the C-terminal portion of the kinase domain (residues 294-326) and replaces it with 31 novel amino acids, partially disrupting a well-characterized functional domain. Downgraded from very strong to moderate per PMC6185798 guidance for truncating variants in the last exon that affect a critical functional region but are not expected to undergo NMD. Details ▾Hide ▴
Evidence considered
  • CDK6 loss of function is supported as a germline disease mechanism by targeted literature review (PMID:41514647
  • PMID:25873077
  • PMID:29149451
  • PMID:32941720
  • PMID:10338331).
  • Frameshift predicted to truncate at codon 294 and introduce a premature stop at codon 325
  • removing the C-terminal 32 residues and replacing them with 31 novel amino acids.
  • Variant located in exon 8/8 (last coding exon)
  • NMD not predicted per PMC6185798 criteria.
  • Truncation partially disrupts the C-terminal kinase domain.
Still missing
  • The affected transcript NM_001259.8 is not the MANE Select transcript
  • confirm transcript relevance in the clinical context.
  • The C-terminal truncation is distal
  • functional studies would help clarify whether the domain disruption is sufficient for full PVS1 strength.
  • No exon-level population LoF constraint data available to confirm the exon is not enriched for benign LoF variants.
Sources
pvs1_generic_framework ↗pvs1_gene_contextpvs1_variant_assessment
PM2 ModerateThis variant is absent from gnomAD v2.1 (exomes), gnomAD v4.1 (exomes/genomes), and gnomAD-Canada v1.0 (HostSeq genomes). Under generic ACMG/AMP criteria, absence from large population databases supports PM2 at moderate strength (allele frequency below 0.1% threshold). Details ▾Hide ▴
Evidence considered
  • Absent from gnomAD v2.1 (141
  • 456 individuals).
  • Absent from gnomAD v4.1 (807
  • 162 individuals).
  • Absent from gnomAD-Canada v1.0.
Sources
gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗

Not met · 5 · evaluated, threshold not reached

PM1 The variant does not lie within a statistically significant mutational hotspot (cancerhotspots.org negative). Although the truncation partially disrupts the C-terminal kinase domain, the affected region (residues 294-326) is the distal C-terminal tail and the last few residues of the kinase domain. The core catalytic residues of the kinase domain are not directly affected by this truncation. The variant does not remove or substantially disrupt a well-characterized critical functional domain that meets the PM1 domain-level threshold for this gene. Details ▾Hide ▴
Evidence considered
  • Cancerhotspots.org: no statistically significant hotspot at this residue.
  • Truncation removes only the distal ~10% of the protein
  • the kinase active site and activation loop are not directly affected.
Still missing
  • Functional domain mapping for CDK6 C-terminus would clarify whether residues 294-326 are critical for protein function and whether PM1 should apply.
PP5 This variant is absent from ClinVar. No reputable source has reported this variant as pathogenic. Details ▾Hide ▴
Evidence considered
  • ClinVar: no entries for NM_001259.8:c.880_955delins.
Sources
clinvar ↗
BA1 This variant is absent from gnomAD v2.1, v4.1, and gnomAD-Canada. The BA1 threshold (allele frequency >1%) is not met. Details ▾Hide ▴
Evidence considered
  • gnomAD v2.1: allele frequency = 0.
  • gnomAD v4.1: allele frequency = 0.
Sources
gnomad_v2 ↗gnomad_v4 ↗
BS1 This variant is absent from population databases. The BS1 threshold (allele frequency >0.3% for non-VCEP assessment) is not met. Details ▾Hide ▴
Evidence considered
  • gnomAD v2.1: allele frequency = 0.
  • gnomAD v4.1: allele frequency = 0.
Sources
gnomad_v2 ↗gnomad_v4 ↗
BP6 This variant is absent from ClinVar. No reputable source has reported this variant as benign. Details ▾Hide ▴
Evidence considered
  • ClinVar: no entries for this variant.
Sources
clinvar ↗

Not assessed · 11 · no assessment recorded

PS2 No de novo data available; parental testing was not reported in case materials. Details ▾Hide ▴
Still missing
  • No parental genotype data to evaluate de novo status.
PS3 No functional studies identified for this specific variant or for a systematically characterized range that includes codon 294 in CDK6. The literature pass returned zero PMIDs. Details ▾Hide ▴
Still missing
  • No functional data available for this variant in any curated or literature source.
PS4 No case-control or case-series data available for this variant. The variant is absent from ClinVar and no affected individuals have been reported. Details ▾Hide ▴
Still missing
  • No affected individuals reported with this specific variant.
PM6 No de novo data available; no parental testing results were provided in case materials. Details ▾Hide ▴
Still missing
  • No parental genotype data to confirm de novo status.
PP1 No segregation data available for this variant. Details ▾Hide ▴
Still missing
  • No family segregation data available.
PP4 No clinical phenotype or family history data were provided in the case materials to assess specificity for a CDK6-related disorder. Details ▾Hide ▴
Still missing
  • No clinical phenotype data available for PP4 assessment.
BS2 No data available on observation of this variant in healthy adult individuals for a fully penetrant disorder. Details ▾Hide ▴
Still missing
  • No healthy adult carrier data available.
BS3 No functional studies identified for this variant demonstrating no damaging effect on protein function. Details ▾Hide ▴
Still missing
  • No functional data available.
BS4 No segregation data available to evaluate lack of segregation in affected family members. Details ▾Hide ▴
Still missing
  • No family segregation data available.
BP2 No data available on observation of this variant in trans with a pathogenic variant for a fully penetrant dominant disorder. Details ▾Hide ▴
Still missing
  • No trans-phase genotype data available.
BP5 No data available on whether the proband carries an alternative molecular basis for disease. Details ▾Hide ▴
Still missing
  • No alternate molecular diagnosis data available.
Not applicable · 10· recorded as not applicable Show reasons ▾Hide reasons ▴
PS1 N/AFrameshift variant; PS1 applies only when the variant results in the same amino acid change as a known pathogenic variant. Details ▾Hide ▴

No further detail was recorded.

PM4 N/AFrameshift variant; PM4 applies to in-frame deletions/insertions in non-repeat regions and stop-loss variants, not to frameshift alterations. Details ▾Hide ▴

No further detail was recorded.

PM5 N/AFrameshift variant; PM5 requires a novel missense change at a residue where a different missense change has been established as pathogenic. The PM5 candidate pipeline was unable to identify same-residue missense comparators for this frameshift variant. Details ▾Hide ▴

No further detail was recorded.

PP2 N/AFrameshift variant; PP2 applies to missense variants in genes with a low rate of benign missense variation where missense variants are a common disease mechanism. Details ▾Hide ▴

No further detail was recorded.

PP3 N/AREVEL, BayesDel, and SpliceAI scores are not available for this frameshift variant. Computational in silico predictors are not validated for frameshift variants and should not be used for PP3/BP4 assessment. Details ▾Hide ▴
Evidence considered
  • REVEL: not applicable (indel
  • not SNV).
  • BayesDel: not applicable (indel
  • SpliceAI: no scores available for this variant.
BP1 N/AFrameshift variant; BP1 applies to missense variants in genes where primarily truncating variants cause disease. Details ▾Hide ▴

No further detail was recorded.

BP3 N/AFrameshift variant; BP3 applies to in-frame deletions or insertions in repetitive regions without known function. Details ▾Hide ▴

No further detail was recorded.

BP4 N/AFrameshift variant; REVEL, BayesDel, and SpliceAI are not applicable to frameshift variants and computational predictors are not validated for this variant class. Details ▾Hide ▴
Evidence considered
  • REVEL: not applicable (indel).
  • BayesDel: not applicable (indel).
  • SpliceAI: no scores available.
BP7 N/AFrameshift variant; BP7 applies to synonymous variants for which splicing prediction algorithms predict no impact on the splice consensus sequence. Details ▾Hide ▴

No further detail was recorded.

PS5 N/AFrameshift variant; PS5 requires the same amino acid change as an established pathogenic variant and is not applicable to frameshift alterations. Details ▾Hide ▴

No further detail was recorded.

Identifiers

Gene
CDK6
Transcript
NM_001259.8
Coding (HGVS c.)
NM_001259.8:c.880_955delinsTCTGGCTGGGCGGCAGGTGGGAATCCAGGTTTTCTTTGCACCTTTCC
Protein (HGVS p.)
NP_001250.1:p.(Ala294SerfsTer31)
GRCh38
chr7:92615166 TCTGGCTGGGCGGCAGGTGGGAATCCAGGTTTTCTTTGCACCTTTCCAGGTCCTGGAAGTATGGGTGAGACAGGGC>GGAAAGGTGCAAAGAAAACCTGGATTCCCACCTGCCGCCCAGCCAGA
GRCh37
chr7:92244480 TCTGGCTGGGCGGCAGGTGGGAATCCAGGTTTTCTTTGCACCTTTCCAGGTCCTGGAAGTATGGGTGAGACAGGGC>GGAAAGGTGCAAAGAAAACCTGGATTCCCACCTGCCGCCCAGCCAGA

Gene diagram

Every interpreted variant in CDK6, mapped onto the exon structure of NM_001259.8. Select a row to find it on the plot.

CDK6NM_001259.8
Fetching transcript structure from UCSC…
gnomAD v4.1 Allele count data not recorded
gnomAD v2.1 Allele count data not recorded
gnomAD-Canada v1.0 Allele count data not recorded

Statements

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

Other predictors

REVEL
Not available
BayesDel
Not available

How the predictions were used

PP3 N/AREVEL, BayesDel, and SpliceAI scores are not available for this frameshift variant. Computational in silico predictors are not validated for frameshift variants and should not be used for PP3/BP4 assessment. Details ▾Hide ▴
Evidence considered
  • REVEL: not applicable (indel
  • not SNV).
  • BayesDel: not applicable (indel
  • SpliceAI: no scores available for this variant.
BP4 N/AFrameshift variant; REVEL, BayesDel, and SpliceAI are not applicable to frameshift variants and computational predictors are not validated for this variant class. Details ▾Hide ▴
Evidence considered
  • REVEL: not applicable (indel).
  • BayesDel: not applicable (indel).
  • SpliceAI: no scores available.
BP7 N/AFrameshift variant; BP7 applies to synonymous variants for which splicing prediction algorithms predict no impact on the splice consensus sequence. Details ▾Hide ▴

No further detail was recorded.

0 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata.

Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.

gnomAD v4.1 Captured gnomAD v4.1 source record Open source ↗
gnomAD v2.1 Captured gnomAD v2.1 source record Open source ↗
SpliceAI Lookup Captured SpliceAI source record Open source ↗
ClinVar Captured ClinVar source record Open source ↗
COSMIC Captured COSMIC source record Open source ↗
Cancer hotspots Captured Cancer Hotspots source record Open source ↗
OncoKB Captured OncoKB source record Open source ↗

All source links

Statements for reports

The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

ClinVar

This variant is absent from ClinVar.

Functional

OncoKB identified curated literature and non-variant-specific oncogenicity context for review; listed oncogenicity label: Unknown Oncogenic Effect.

Somatic

This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.