About RUNX1
No gene-level summary was recorded for this case.
Previous versions
Variant interpretation report
RUNX1 c.529_551dup, p.(Gln185SerfsTer34)
Classification
Pathogenic
Variant description:
No variant summary was recorded for this case.
Five-step scale from benign to pathogenic. This variant is pathogenic. Select a step to read what it means.
Pathogenic.A pathogenic classification under the recorded framework.
In plain language
Gene-level background from the recorded interpretation.
Words with a dotted underline have a short definition. Hover or tap them.
LYFE Sciences is an AI system, and it can make mistakes.
Criteria may be applied incorrectly, sources may be misread, and a
confident-looking classification can still be wrong.
Double-check every criterion and its underlying evidence
before relying on any call.
01The reasoning
How it was classified
The recorded framework is ClinGen RUNX1 VCEP v3.1.0. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.
Recorded applied criteria
The applied criteria and their strengths are shown as assessed under the stated framework.
Pathogenic evidence criteria: 3
Benign evidence criteria: 0
Pathogenic criteria applied · 3
PVS1Very strong
PVS1 · very strong
This duplication causes a frameshift, NM_001754.4:c.529_551dup, predicted to produce p.(Gln185SerfsTer34) in exon 6 of 9 with premature truncation well upstream of the 3' end of RUNX1. RUNX1 loss of function is an established disease mechanism in the MM-VCEP specification, so this finding supports PVS1 at Very Strong strength.
PM2Supporting
PM2 · supporting
This variant is absent from gnomAD v2.1 and gnomAD v4.1. The observed frequency is therefore 0, which is below the RUNX1 MM-VCEP PM2_Supporting threshold of less than or equal to 0.00005.
PM5Supporting
PM5 · supporting
RUNX1 MM-VCEP allows PM5_Supporting for nonsense or frameshift variants downstream of c.98 when splicing is not predicted to be disrupted and PM1 is not applied. This frameshift occurs at c.529_551, which is downstream of c.98, and SpliceAI shows a maximum delta score of 0.01, which is below the less than or equal to 0.20 splice caveat.
Benign criteria applied · 0
No benign criterion marked as applied in the recorded assessment.
Recorded classification: Pathogenic
RUNX1 MM-VCEP/CSPEC point-based final-classification framework (Tavtigian et al., 2020 Bayesian point system; version 3.1.0). Applied points: PVS1_Very Strong = 8, PM2_Supporting = 1, PM5_Supporting = 1; total = 10 points.
02The sources
Evidence at a glance
Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.
gnomAD v4.1
gnomAD v2.1
Population frequency
Not recorded
gnomAD v4.1 allele counts were not recorded for this variant.
gnomAD v2.1
Absent from gnomAD v2.1.
No screenshot for this evidence
Computational predictions
Not recorded
No SpliceAI or REVEL score is recorded in the fields used for this tile.
No listed criterion applied
ClinVar submissions
Not recorded
A ClinVar laboratory submission summary was not recorded.
Context only
ClinVar ↗
Functional evidence
Statement recorded
OncoKB classifies this variant as Likely Oncogenic; biological effect: Likely Loss-of-function.
No listed criterion applied
OncoKB ↗
COSMIC
Cancer Hotspots
Somatic evidence
Not assessed
No COSMIC evidence statement is recorded in this case.
Cancer Hotspots
This variant does not lie in a statistically significant hotspot.
Context only
For specialists
Technical detail
ACMG/AMP criteria under ClinGen RUNX1 VCEP v3.1.0, with the data and sources behind each one.
28 criteria with recorded statuses: 3 met · 4 not met · 9 not assessed · 12 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.
Met
Not met
Not assessed
Not applicable
The RUNX1 c.529_551dup (p.(Gln185SerfsTer34)) variant has not been observed in COSMIC and has not been reported in ClinVar; OncoKB classifies this variant as Likely Oncogenic with a likely loss-of-function effect.
This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed allele frequency is 0, which is below the RUNX1 MM-VCEP PM2_Supporting threshold of less than or equal to 0.00005.
This duplication is predicted to cause a frameshift, p.(Gln185SerfsTer34), and SpliceAI predicts no significant splice impact with a maximum delta score of 0.01, which is consistent with applying PVS1 and PM5_Supporting under the RUNX1 MM-VCEP framework.
No criteria match.
Met · 3
PVS1 Very strongThis duplication causes a frameshift, NM_001754.4:c.529_551dup, predicted to produce p.(Gln185SerfsTer34) in exon 6 of 9 with premature truncation well upstream of the 3' end of RUNX1. RUNX1 loss of function is an established disease mechanism in the MM-VCEP specification, so this finding supports PVS1 at Very Strong strength. Details ▾Hide ▴
Rule
PVS1
Evidence considered
- RUNX1 MM-VCEP includes PVS1 guidance.
- pvs1_gene_context.json: lof_mechanism_supported = true; pvs1_gene_gate = eligible.
- pvs1_variant_assessment.json: variant_bucket = frameshift; suggested_default_strength = PVS1.
- prefetch.json: exon 6; protein consequence NP_001745.2:p.(Gln185SerfsTer34).
Sources
PM2 SupportingThis variant is absent from gnomAD v2.1 and gnomAD v4.1. The observed frequency is therefore 0, which is below the RUNX1 MM-VCEP PM2_Supporting threshold of less than or equal to 0.00005. Details ▾Hide ▴
Rule
PM2_Supporting
Evidence considered
- gnomAD v2.1: absent.
- gnomAD v4.1: absent.
- RUNX1 MM-VCEP PM2_Supporting threshold: frequency less than or equal to 0.00005.
Sources
PM5 SupportingRUNX1 MM-VCEP allows PM5_Supporting for nonsense or frameshift variants downstream of c.98 when splicing is not predicted to be disrupted and PM1 is not applied. This frameshift occurs at c.529_551, which is downstream of c.98, and SpliceAI shows a maximum delta score of 0.01, which is below the less than or equal to 0.20 splice caveat. Details ▾Hide ▴
Rule
PM5_Supporting
Evidence considered
- RUNX1 MM-VCEP: PM5_Supporting applies to nonsense/frameshift variants downstream of c.98 with no predicted splice effect and without PM1.
- SpliceAI max delta score = 0.01.
- RUNX1 pilot precedent includes downstream frameshift c.292del with PM5_supporting, PM2_supporting, and PVS1.
Sources
cspec ↗spliceai ↗vcep_m_y_e_l_o_i_d___m_a_l_i_g_n_a_n_c_y___v_c_e_p___r_u_n_x_1___p_i_l_o_t___r_e_s_u_l_t_s
Not met · 4 · evaluated, threshold not reached
PM4 This variant is a frameshift duplication, not an in-frame deletion/insertion or stop-loss variant, so PM4 does not apply. Details ▾Hide ▴
Evidence considered
- pvs1_variant_assessment.json: variant_bucket = frameshift.
- RUNX1 MM-VCEP limits PM4 to in-frame indels and stop-loss variants.
Sources
cspec ↗pvs1_variant_assessment
PM1 Although codon 185 lies within the RUNX1 runt homology domain, available evidence does not support applying PM1 to this truncating frameshift variant. In the reviewed RUNX1 MM-VCEP pilot precedent, a downstream frameshift variant was curated with PVS1 and PM5_Supporting rather than PM1, and the specification states that PM5 should not be combined with PM1. Details ▾Hide ▴
Evidence considered
- Codon 185 is within RHD residues 89-204.
- RUNX1 MM-VCEP pilot precedent for c.292del used PM2_supporting, PM5_supporting, and PVS1.
- RUNX1 MM-VCEP states PM5 cannot be used if PM1 is applied.
Sources
cspec ↗vcep_m_y_e_l_o_i_d___m_a_l_i_g_n_a_n_c_y___v_c_e_p___r_u_n_x_1___p_i_l_o_t___r_e_s_u_l_t_s
BA1 This variant is absent from gnomAD v2.1 and gnomAD v4.1. The observed frequency is 0, which is below the RUNX1 BA1 threshold of greater than or equal to 0.0015, so BA1 is not met. Details ▾Hide ▴
Evidence considered
- gnomAD v2.1: absent.
- gnomAD v4.1: absent.
- RUNX1 BA1 threshold: frequency greater than or equal to 0.0015.
Sources
BS1 This variant is absent from gnomAD v2.1 and gnomAD v4.1. The observed frequency is 0, which is below the RUNX1 BS1 range of 0.00015 to 0.0015, so BS1 is not met. Details ▾Hide ▴
Evidence considered
- gnomAD v2.1: absent.
- gnomAD v4.1: absent.
- RUNX1 BS1 range: 0.00015 to 0.0015.
Sources
Not assessed · 9 · no assessment recorded
PP1 No segregation data were identified, so co-segregation with RUNX1-related disease cannot be assessed. Details ▾Hide ▴
Evidence considered
- No family segregation evidence was identified in the available sources.
Still missing
- Informative family segregation data
PS2 No confirmed de novo occurrence with maternity and paternity established was identified, so PS2 cannot be assessed. Details ▾Hide ▴
Evidence considered
- No de novo evidence was identified in the available sources.
Still missing
- Confirmed de novo occurrence(s) in an affected individual
BP2 No cis/trans observation with another pathogenic RUNX1 variant was identified, so BP2 cannot be assessed. Details ▾Hide ▴
Evidence considered
- No phase data were identified in the available sources.
Still missing
- Phase data with another pathogenic variant
BS3 No variant-specific functional studies demonstrating normal RUNX1 function were identified, so BS3 cannot be applied. Details ▾Hide ▴
Evidence considered
- OncoKB provides a classification statement but no normal-function assay for this variant.
Still missing
- Validated functional assay showing normal function
Sources
PS1 No previously established pathogenic or likely pathogenic variant producing the same amino acid change or the same splice event was identified, so PS1 was not applied. Details ▾Hide ▴
Evidence considered
- ClinVar: no record identified.
- RUNX1 pilot file: no matching same amino acid change identified in reviewed precedent material.
Still missing
- Previously established pathogenic or likely pathogenic same amino acid change or same splice event
Sources
clinvar ↗vcep_m_y_e_l_o_i_d___m_a_l_i_g_n_a_n_c_y___v_c_e_p___r_u_n_x_1___p_i_l_o_t___r_e_s_u_l_t_s
PM6 No assumed de novo occurrence in an affected individual was identified, so PM6 cannot be assessed. Details ▾Hide ▴
Evidence considered
- No assumed de novo evidence was identified in the available sources.
Still missing
- Assumed de novo occurrence(s) in an affected individual
PS4 No proband data meeting RUNX1 phenotypic criteria were identified, so PS4 cannot be applied. Details ▾Hide ▴
BS4 No evidence showing non-segregation with disease in informative meioses was identified, so BS4 cannot be assessed. Details ▾Hide ▴
Evidence considered
- No family non-segregation evidence was identified in the available sources.
Still missing
- Informative non-segregation data
PS3 No variant-specific transactivation assay or qualifying secondary functional assay was identified, so PS3 was not applied. Details ▾Hide ▴
Evidence considered
- OncoKB classifies the variant as likely oncogenic with likely loss-of-function effect, but no qualifying MM-VCEP functional assay data were identified.
Still missing
- Validated RUNX1 functional assay data for this variant
Sources
Not applicable · 12· recorded as not applicable Show reasons ▾Hide reasons ▴
PP4 N/APP4 is not applicable in the RUNX1 MM-VCEP framework because the FPD/AML phenotype is not considered sufficiently specific for a single genetic etiology. Details ▾Hide ▴
PP5 N/APP5 is not used in this VCEP framework. Details ▾Hide ▴
BP4 N/ABP4 in the RUNX1 MM-VCEP framework is defined for missense, synonymous, and intronic variants. This variant is a frameshift duplication, so BP4 is not applicable. Details ▾Hide ▴
Evidence considered
- RUNX1 MM-VCEP BP4 is restricted to missense, synonymous, and intronic variants.
- Variant consequence is frameshift.
Sources
BP3 N/ABP3 is not applicable in the RUNX1 MM-VCEP framework. Details ▾Hide ▴
BP6 N/ABP6 is not used in this VCEP framework. Details ▾Hide ▴
BP7 N/ABP7 in the RUNX1 MM-VCEP framework is defined for synonymous and intronic variants. This variant is a frameshift duplication, so BP7 is not applicable. Details ▾Hide ▴
Evidence considered
- RUNX1 MM-VCEP BP7 is restricted to synonymous and intronic variants.
- Variant consequence is frameshift.
Sources
BP5 N/ABP5 is not applicable in the RUNX1 MM-VCEP framework. Details ▾Hide ▴
BS2 N/ABS2 is not applicable in the RUNX1 MM-VCEP framework. Details ▾Hide ▴
PP3 N/APP3 in the RUNX1 MM-VCEP framework is defined for missense, synonymous, and selected intronic variants. This variant is a frameshift duplication, so PP3 is not applicable. Details ▾Hide ▴
Evidence considered
- RUNX1 MM-VCEP PP3 is restricted to missense, synonymous, and selected intronic variants.
- Variant consequence is frameshift.
Sources
PP2 N/APP2 is not applicable in the RUNX1 MM-VCEP framework. Details ▾Hide ▴
BP1 N/ABP1 is not applicable in the RUNX1 MM-VCEP framework. Details ▾Hide ▴
PM3 N/APM3 is not applicable in the RUNX1 MM-VCEP framework. Details ▾Hide ▴
Identifiers
- Gene
- RUNX1
- Transcript
- NM_001754.4
- Coding (HGVS c.)
- NM_001754.4:c.529_551dup
- Protein (HGVS p.)
- NP_001745.2:p.(Gln185SerfsTer34)
- GRCh38
- chr21:34859535 C>CGGTGGGTTTGTGAAGACAGTGAT
- GRCh37
- chr21:36231832 C>CGGTGGGTTTGTGAAGACAGTGAT
Gene diagram
Every interpreted variant in RUNX1, mapped onto the exon structure of NM_001754.4. Select a row to find it on the plot.
RUNX1NM_001754.4
Fetching transcript structure from UCSC…
Exons
—
Transcript span
—
Strand
—
Variants mapped
—
Source
UCSC ncbiRefSeqCurated
All variants in RUNX1
—
Select a row to find it on the plot; use the link to open its page.
| Protein | Location | Classification | Link |
|---|
gnomAD v4.1
Allele count data not recorded
gnomAD v2.1
Allele count data not recorded
Statements
gnomAD v4.1
Absent from gnomAD v4.1.
gnomAD v2.1
Absent from gnomAD v2.1.
Other predictors
- REVEL
- Not available
- BayesDel
- Not available
How the predictions were used
BP4 N/ABP4 in the RUNX1 MM-VCEP framework is defined for missense, synonymous, and intronic variants. This variant is a frameshift duplication, so BP4 is not applicable. Details ▾Hide ▴
Evidence considered
- RUNX1 MM-VCEP BP4 is restricted to missense, synonymous, and intronic variants.
- Variant consequence is frameshift.
Sources
BP7 N/ABP7 in the RUNX1 MM-VCEP framework is defined for synonymous and intronic variants. This variant is a frameshift duplication, so BP7 is not applicable. Details ▾Hide ▴
Evidence considered
- RUNX1 MM-VCEP BP7 is restricted to synonymous and intronic variants.
- Variant consequence is frameshift.
Sources
PP3 N/APP3 in the RUNX1 MM-VCEP framework is defined for missense, synonymous, and selected intronic variants. This variant is a frameshift duplication, so PP3 is not applicable. Details ▾Hide ▴
Evidence considered
- RUNX1 MM-VCEP PP3 is restricted to missense, synonymous, and selected intronic variants.
- Variant consequence is frameshift.
Sources
Statement
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.01).
0 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata.
Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.
gnomAD v4.1
Captured gnomAD v4.1 source record
Open source ↗
gnomAD v2.1
Captured gnomAD v2.1 source record
Open source ↗
SpliceAI Lookup
Captured SpliceAI source record
Open source ↗
ClinVar
Captured ClinVar source record
Open source ↗
COSMIC
Captured COSMIC source record
Open source ↗
Cancer hotspots
Captured Cancer Hotspots source record
Open source ↗
OncoKB
Captured OncoKB source record
Open source ↗
ClinGen CSpec
Captured ClinGen CSpec source record
Open source ↗
All source links
- ClinGen CSpec ↗cspec.genome.network/cspec/ui/svi/doc/135637580
- ClinVar ↗www.ncbi.nlm.nih.gov/clinvar/?term=NM_001754.4%3Ac.529_551dup
- gnomAD v2.1 ↗gnomad.broadinstitute.org/variant/21-36231832-C-CGGTGGGTTTGTGAA…
- gnomAD v4.1 ↗gnomad.broadinstitute.org/variant/chr21-34859535-C-CGGTGGGTTTGT…
- SpliceAI Lookup ↗spliceailookup.broadinstitute.org/#variant=NM_001754.4%3Ac.529_…
- OncoKB ↗www.oncokb.org/gene/RUNX1/Q185Sfs*
- COSMIC ↗cancer.sanger.ac.uk/cosmic/search?q=RUNX1+c.529_551dup
- Cancer hotspots ↗www.cancerhotspots.org/
Statements for reports
The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.
gnomAD v4.1
Absent from gnomAD v4.1.
gnomAD v2.1
Absent from gnomAD v2.1.
ClinVar
This variant is absent from ClinVar.
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.01).
Functional
OncoKB classifies this variant as Likely Oncogenic; biological effect: Likely Loss-of-function.
Somatic
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Cancer Hotspots
This variant does not lie in a statistically significant hotspot.