About GNA11
No gene-level summary was recorded for this case.
Previous versions
Variant interpretation report
GNA11 c.735+1_736-1del, p.?
Classification
Likely pathogenic
Variant description:
No variant summary was recorded for this case.
Five-step scale from benign to pathogenic. This variant is likely pathogenic. Select a step to read what it means.
Likely pathogenic.A likely pathogenic classification under the recorded framework.
In plain language
Gene-level background from the recorded interpretation.
Words with a dotted underline have a short definition. Hover or tap them.
LYFE Sciences is an AI system, and it can make mistakes.
Criteria may be applied incorrectly, sources may be misread, and a
confident-looking classification can still be wrong.
Double-check every criterion and its underlying evidence
before relying on any call.
01The reasoning
How it was classified
The recorded framework is Not recorded. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.
Recorded applied criteria
The applied criteria and their strengths are shown as assessed under the stated framework.
Pathogenic evidence criteria: 2
Benign evidence criteria: 0
Pathogenic criteria applied · 2
PVS1Very strong
PVS1 · very strong
NM_002067.5:c.735+1_736-1del deletes the canonical splice donor (+1) and acceptor (-1) sites of intron 5, abrogating normal splicing. GNA11 loss of function is an established germline disease mechanism supported by targeted literature review. SpliceAI predicts strong splice disruption (max delta score = 1.00, with both donor loss and acceptor loss predicted at delta = 1.0). Per ClinGen SVI PVS1 recommendations (PMC6185798), canonical ±1,2 splice variants qualify for PVS1 at very strong strength in genes with established LoF mechanism. No downgrade factors identified.
PM2Moderate
PM2 · moderate
NM_002067.5:c.735+1_736-1del is absent from gnomAD v2.1 and extremely rare in gnomAD v4.1 (AF = 1.24e-06, 2/1,613,802 alleles, no homozygotes). The population frequency (0.00012%) is well below the 0.1% PM2 threshold for non-VCEP adjudication. Absent from gnomAD-Canada v1.0.
Benign criteria applied · 0
No benign criterion marked as applied in the recorded assessment.
Recorded classification: Likely pathogenic
gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PVS1 very strong, PM2 moderate; combination = 1 very strong + 1 moderate, which maps to Likely Pathogenic.
02The sources
Evidence at a glance
Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.
gnomAD v4.1
gnomAD v2.1
Population frequency
2 / 1,613,802 alleles
gnomAD v4.1: 2 / 1,613,802 alleles. Recorded AF 1.23931e-06. Recorded homozygote count 0.
gnomAD v2.1
Absent from gnomAD v2.1.
gnomAD-Canada
Absent from gnomAD-Canada v1.0.
SpliceAI score
1.000 maximum delta
Recorded SpliceAI maximum delta score: 1.000. Refer to the recorded PP3/BP4 rationale for interpretation.
No listed criterion applied
SpliceAI ↗
ClinVar submissions
Not recorded
A ClinVar laboratory submission summary was not recorded.
Context only
ClinVar ↗
No screenshot for this evidence
Functional evidence
Not recorded
No standalone functional evidence summary is recorded in evidence_summary.functional.
No listed criterion applied
OncoKB ↗
Somatic evidence
1 recorded samples
This variant has previously been reported in somatic cancers (COSMIC; COSV107230858, n = 1 times).
Context only
COSMIC ↗
For specialists
Technical detail
ACMG/AMP criteria under Not recorded, with the data and sources behind each one.
29 criteria with recorded statuses: 2 met · 18 not met · 3 not assessed · 6 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.
Met
Not met
Not assessed
Not applicable
NM_002067.5:c.735+1_736-1del is a canonical splice site deletion removing the donor (+1) and acceptor (-1) sites of intron 5 of GNA11, qualifying for PVS1 at very strong strength under ClinGen SVI PVS1 recommendations (PMC6185798), with GNA11 loss of function established as a germline disease mechanism.
The variant is absent from gnomAD v2.1 and is observed at an extremely low frequency in gnomAD v4.1 (AF = 1.24e-06, 2/1,613,802 alleles, 0 homozygotes), meeting PM2 at moderate strength.
Per generic ACMG/AMP 2015 combination rules (Richards et al., PMID:25741868), one Very Strong criterion (PVS1) plus one Moderate criterion (PM2) yields a classification of Likely Pathogenic.
No criteria match.
Met · 2
PVS1 Very strongNM_002067.5:c.735+1_736-1del deletes the canonical splice donor (+1) and acceptor (-1) sites of intron 5, abrogating normal splicing. GNA11 loss of function is an established germline disease mechanism supported by targeted literature review. SpliceAI predicts strong splice disruption (max delta score = 1.00, with both donor loss and acceptor loss predicted at delta = 1.0). Per ClinGen SVI PVS1 recommendations (PMC6185798), canonical ±1,2 splice variants qualify for PVS1 at very strong strength in genes with established LoF mechanism. No downgrade factors identified. Details ▾Hide ▴
Evidence considered
- Canonical splice donor (+1) and acceptor (-1) deletion at intron 5 of NM_002067.5
- GNA11 germline loss of function mechanism supported by literature (PMID:37053535
- PMID:39344744
- PMID:32430905
- PMID:35181412
- PMID:35700413)
- SpliceAI max delta = 1.00
- DS_AL = 1.00
- DS_DL = 1.00
- Per PMC6185798: canonical splice variants evaluated under generic PVS1 framework
Still missing
- Transcript-level confirmation of aberrant splicing (RNA studies) not available
- Exon 5 relevance and NMD prediction not experimentally validated
Sources
PM2 ModerateNM_002067.5:c.735+1_736-1del is absent from gnomAD v2.1 and extremely rare in gnomAD v4.1 (AF = 1.24e-06, 2/1,613,802 alleles, no homozygotes). The population frequency (0.00012%) is well below the 0.1% PM2 threshold for non-VCEP adjudication. Absent from gnomAD-Canada v1.0. Details ▾Hide ▴
Evidence considered
- Absent from gnomAD v2.1
- gnomAD v4.1: AF = 1.24e-06 (2/1
- 613
- 802 alleles)
- 0 homozygotes
- Best subpopulation AF = 1.60e-05 (0.0016%) in Remaining individuals
- Absent from gnomAD-Canada v1.0
Sources
Not met · 18 · evaluated, threshold not reached
PS3 No well-established functional studies have been identified for NM_002067.5:c.735+1_736-1del. COSMIC COSV107230858 reports a single somatic observation (n=1), which does not constitute well-established functional evidence under ACMG/AMP guidelines. Details ▾Hide ▴
Evidence considered
- COSMIC COSV107230858: single somatic observation
- not functional evidence
Still missing
- No variant-specific functional studies (RNA
- protein
- or cellular assays) identified
- SpliceAI prediction alone is captured under PVS1 and does not independently satisfy PS3
PS4 No case-control or odds ratio data are available comparing the prevalence of this variant in affected individuals versus the general population. While the variant is extremely rare in gnomAD v4.1 (AF = 1.24e-06), this alone does not satisfy PS4 without affected cohort data. Details ▾Hide ▴
Evidence considered
- gnomAD v4.1 AF = 1.24e-06 (2/1
- 613
- 802 alleles)
Still missing
- No affected cohort prevalence data available
Sources
PM1 This variant is not located in an established mutational hotspot or critical functional domain for GNA11. The hotspot assessment identified no significant residue-level hotspot and the variant was not listed in curated hotspot databases. Details ▾Hide ▴
Evidence considered
- Hotspot assessment: residue_significant = false
- exact_variant_listed = no
PP3 SpliceAI predicts strong splice disruption (max delta = 1.00, DS_AL = 1.00, DS_DL = 1.00). However, per ClinGen SVI PVS1 recommendations (PMC6185798), PP3 should not be stacked with PVS1 for the same splice-effect prediction evidence. The splice prediction data are already captured in the PVS1 assessment at very strong strength. REVEL and BayesDel scores are not available (not an SNV). HCI prior is not available for GNA11. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta = 1.00 (DS_AL = 1.00
- DS_DL = 1.00
- DS_AG = 0.69)
- PP3 not stacked per PMC6185798 guidance for canonical splice variants already captured by PVS1
Sources
PP4 No patient phenotype or family history data are available for this case. PP4 requires that the patient's phenotype or family history is highly specific for a disease with a single genetic etiology. Details ▾Hide ▴
Still missing
- No phenotype or clinical history data available for the proband
PP5 NM_002067.5:c.735+1_736-1del is absent from ClinVar. No reputable source has reported this variant as pathogenic. Details ▾Hide ▴
BA1 The highest subpopulation allele frequency for NM_002067.5:c.735+1_736-1del in gnomAD v4.1 is 1.60e-05 (0.0016%) in the Remaining individuals population. This is well below the 1% BA1 threshold for non-VCEP adjudication. Details ▾Hide ▴
Evidence considered
- gnomAD v4.1 max subpopulation AF = 0.0016% (Remaining individuals)
- far below 1% BA1 threshold
Sources
BS1 The highest subpopulation allele frequency in gnomAD v4.1 is 1.60e-05 (0.0016%) in the Remaining individuals population. This is well below the 0.3% BS1 threshold for non-VCEP adjudication. Details ▾Hide ▴
Evidence considered
- gnomAD v4.1 max subpopulation AF = 0.0016%
- far below 0.3% BS1 threshold
Sources
BS2 Two heterozygous carriers are observed in gnomAD v4.1 (2/1,613,802 alleles), but no phenotype data are available for these individuals. BS2 requires observation in a healthy adult individual for a fully penetrant disorder expected to occur at an early age. Two heterozygotes without phenotype confirmation are insufficient to satisfy BS2. Details ▾Hide ▴
Evidence considered
- gnomAD v4.1: 2 heterozygous carriers observed
- no homozygotes
- no phenotype data available
Still missing
- No phenotype data for gnomAD carriers
Sources
BS3 No well-established functional studies have been identified that demonstrate no damaging effect of this variant on the gene product. The SpliceAI prediction (max delta = 1.00) indicates a strong deleterious splice effect, contrary to a benign functional interpretation. Details ▾Hide ▴
Evidence considered
- SpliceAI predicts strong splice disruption (max delta = 1.00)
- inconsistent with benign functional effect
Still missing
- No functional studies assessing this specific variant
Sources
BS4 No family segregation data are available for this variant. BS4 requires lack of segregation with disease in affected family members. Details ▾Hide ▴
Still missing
- No family segregation data available
BP1 BP1 applies to missense variants in genes where truncating variants are the primary known disease mechanism. NM_002067.5:c.735+1_736-1del is a canonical splice site deletion, not a missense variant. BP1 does not apply. Details ▾Hide ▴
No further detail was recorded.
BP2 No data are available regarding observation of this variant in trans with a pathogenic variant for a fully penetrant dominant disorder. None of the reviewed literature or databases provide such evidence. Details ▾Hide ▴
Still missing
- No trans-phase data available
BP3 BP3 applies to in-frame deletions or insertions in repetitive regions without a known function. NM_002067.5:c.735+1_736-1del is a canonical splice site deletion, not an in-frame deletion. BP3 does not apply. Details ▾Hide ▴
No further detail was recorded.
BP4 Multiple lines of computational evidence do NOT suggest a benign impact. SpliceAI predicts strong splice disruption (max delta = 1.00; DS_AL = 1.00, DS_DL = 1.00), supporting a deleterious effect on splicing. No in silico evidence suggests a benign interpretation. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta = 1.00
- consistent with deleterious splice effect
- not benign
Sources
BP5 No data are available identifying an alternate molecular basis for disease in an individual carrying this variant. No case-level data are available for this variant at all. Details ▾Hide ▴
Still missing
- No case-level molecular data available
BP6 NM_002067.5:c.735+1_736-1del is absent from ClinVar. No reputable source has reported this variant as benign. Details ▾Hide ▴
Evidence considered
- Variant absent from ClinVar
- no benign classification from any source
Sources
BP7 BP7 applies to synonymous variants for which splicing prediction algorithms predict no impact on the splice consensus sequence. NM_002067.5:c.735+1_736-1del is a canonical splice site deletion, not a synonymous variant. BP7 does not apply. Details ▾Hide ▴
No further detail was recorded.
Not assessed · 3 · no assessment recorded
PS2 No de novo data are available for this variant. PS2 requires confirmed de novo occurrence with both maternity and paternity confirmed. Details ▾Hide ▴
Still missing
- No de novo testing data available
PM6 No de novo data are available for this variant. PM6 requires a de novo observation with confirmed maternity and paternity, or a de novo observation with unconfirmed parentage (supporting strength). Details ▾Hide ▴
Still missing
- No de novo testing data available
PP1 No segregation data are available for this variant. PP1 requires cosegregation with disease in multiple affected family members. Details ▾Hide ▴
Still missing
- No family segregation data available
Not applicable · 6· recorded as not applicable Show reasons ▾Hide reasons ▴
PS1 N/AThis is a canonical splice site deletion with unknown protein consequence (p.?). PS1 requires a same-amino-acid change comparator from a known pathogenic variant, which is not applicable to splice variants. Details ▾Hide ▴
No further detail was recorded.
PM3 N/ASkipped per adjudication directive. PM3 (in trans with pathogenic variant for recessive disorders) not assessed for this case. Details ▾Hide ▴
No further detail was recorded.
PM4 N/APM4 applies to in-frame deletions/insertions in non-repeat regions or stop-loss variants resulting in protein length changes. NM_002067.5:c.735+1_736-1del is a canonical splice site deletion with unknown protein consequence (p.?); PM4 is not applicable to splice variants without confirmed in-frame outcome. Details ▾Hide ▴
No further detail was recorded.
PM5 N/APM5 requires a same-residue missense change from a known pathogenic variant. This splice variant has unknown protein consequence (p.?), and the PM5 candidate assessment confirmed eligible_for_classic_pm5_search = false. No same-residue comparator can be identified. Details ▾Hide ▴
No further detail was recorded.
PP2 N/APP2 applies specifically to missense variants in genes with a low rate of benign missense variation and where missense is a common disease mechanism. NM_002067.5:c.735+1_736-1del is a canonical splice site deletion, not a missense variant. Details ▾Hide ▴
No further detail was recorded.
PS5 N/APS5 is not a standard criterion in the ACMG/AMP 2015 sequence variant interpretation framework (Richards et al., PMID:25741868). Details ▾Hide ▴
No further detail was recorded.
Identifiers
- Gene
- GNA11
- Transcript
- NM_002067.5
- Coding (HGVS c.)
- NM_002067.5:c.735+1_736-1del
- Protein (HGVS p.)
- NP_002058.2:p.?
- GRCh38
- chr19:3119051 GAGGTGGGCCCTGCCCTGAGCAGGGGCAGCGTTGGGGGCCGGGCCTTCCCCACCTGCCAAGCCTGGGTCCCCTCACCTGGGTCCCCCCAGCTGCCCCTTGGGCTGTGTGCAGTGGGGAGGGCCCCTCTGATTCCCTCTGCCTTCGCTCCCGCC>G
- GRCh37
- chr19:3119049 GAGGTGGGCCCTGCCCTGAGCAGGGGCAGCGTTGGGGGCCGGGCCTTCCCCACCTGCCAAGCCTGGGTCCCCTCACCTGGGTCCCCCCAGCTGCCCCTTGGGCTGTGTGCAGTGGGGAGGGCCCCTCTGATTCCCTCTGCCTTCGCTCCCGCC>G
- COSMIC
- COSV107230858
Gene diagram
Every interpreted variant in GNA11, mapped onto the exon structure of NM_002067.5. Select a row to find it on the plot.
GNA11NM_002067.5
Fetching transcript structure from UCSC…
Exons
—
Transcript span
—
Strand
—
Variants mapped
—
Source
UCSC ncbiRefSeqCurated
All variants in GNA11
—
Select a row to find it on the plot; use the link to open its page.
| Protein | Location | Classification | Link |
|---|
gnomAD v4.1
2 / 1,613,802 alleles
AF 1.24e-06 · 0 homozygotes
gnomAD v2.1
Allele count data not recorded
gnomAD-Canada v1.0
Allele count data not recorded
By genetic ancestry
gnomAD v4.1
AF 1.2e-06 · 2 / 1,613,802 alleles · 0 hom
| Remaining individuals1 / 62,496 | 1.6e-05 |
| South Asian1 / 91,082 | 1.1e-05 |
0 alternate alleles recorded in 8 other groups: Admixed American, European (Finnish), Amish, East Asian, Middle Eastern, Ashkenazi Jewish, African/African American, European (non-Finnish).
Statements
gnomAD v4.1
This variant is present in gnomAD v4.1 (AF= 1.23931e-06; MAF= 0.00012%, 2/1613802 alleles, homozygotes = 0) and has highest observed frequency in the Remaining individuals population (AF= 1.6001e-05; MAF= 0.00160%, 1/62496 alleles, homozygotes = 0).
gnomAD v2.1
Absent from gnomAD v2.1.
gnomAD-Canada
Absent from gnomAD-Canada v1.0.
SpliceAI and Pangolin
Other predictors
- REVEL
- Not available
- BayesDel
- Not available
How the predictions were used
PP3 SpliceAI predicts strong splice disruption (max delta = 1.00, DS_AL = 1.00, DS_DL = 1.00). However, per ClinGen SVI PVS1 recommendations (PMC6185798), PP3 should not be stacked with PVS1 for the same splice-effect prediction evidence. The splice prediction data are already captured in the PVS1 assessment at very strong strength. REVEL and BayesDel scores are not available (not an SNV). HCI prior is not available for GNA11. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta = 1.00 (DS_AL = 1.00
- DS_DL = 1.00
- DS_AG = 0.69)
- PP3 not stacked per PMC6185798 guidance for canonical splice variants already captured by PVS1
Sources
BP4 Multiple lines of computational evidence do NOT suggest a benign impact. SpliceAI predicts strong splice disruption (max delta = 1.00; DS_AL = 1.00, DS_DL = 1.00), supporting a deleterious effect on splicing. No in silico evidence suggests a benign interpretation. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta = 1.00
- consistent with deleterious splice effect
- not benign
Sources
BP7 BP7 applies to synonymous variants for which splicing prediction algorithms predict no impact on the splice consensus sequence. NM_002067.5:c.735+1_736-1del is a canonical splice site deletion, not a synonymous variant. BP7 does not apply. Details ▾Hide ▴
No further detail was recorded.
Statement
In silico
SpliceAI predicts possible splice impact for this variant (max delta score = 1.00).
0 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata.
Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.
gnomAD v4.1
2 / 1,613,802 recorded alleles
Open source ↗
gnomAD v2.1
Captured gnomAD v2.1 source record
Open source ↗
SpliceAI Lookup
Recorded maximum delta 1.000
Open source ↗
ClinVar
Captured ClinVar source record
Open source ↗
COSMIC
Captured COSMIC source record
Open source ↗
All source links
- ClinVar ↗www.ncbi.nlm.nih.gov/clinvar/?term=NM_002067.5%3Ac.735%2B1_736-1del
- gnomAD v2.1 ↗gnomad.broadinstitute.org/variant/19-3119049-GAGGTGGGCCCTGCCCTG…
- gnomAD v4.1 ↗gnomad.broadinstitute.org/variant/chr19-3119051-GAGGTGGGCCCTGCC…
- gnomAD-Canada ↗http://192.168.4.76:8001/variant/19-3119051-GAGGTGGGCCCTGCCCTGA…
- SpliceAI Lookup ↗spliceailookup.broadinstitute.org/#variant=NM_002067.5%3Ac.735%…
- OncoKB ↗www.oncokb.org/gene/GNA11/?
- COSMIC ↗cancer.sanger.ac.uk/cosmic/mutation/overview?id=119735872
Statements for reports
The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.
gnomAD v4.1
This variant is present in gnomAD v4.1 (AF= 1.23931e-06; MAF= 0.00012%, 2/1613802 alleles, homozygotes = 0) and has highest observed frequency in the Remaining individuals population (AF= 1.6001e-05; MAF= 0.00160%, 1/62496 alleles, homozygotes = 0).
gnomAD v2.1
Absent from gnomAD v2.1.
gnomAD-Canada
Absent from gnomAD-Canada v1.0.
ClinVar
This variant is absent from ClinVar.
In silico
SpliceAI predicts possible splice impact for this variant (max delta score = 1.00).
Somatic
This variant has previously been reported in somatic cancers (COSMIC; COSV107230858, n = 1 times).