About the gene
No gene-level summary was recorded for this case.
Previous versions
Variant interpretation report
c.284_307delCCCCCGGACTCACACCACAGCCGC
NM_003016.4:c.284_307delCCCCCGGACTCACACCACAGCCGC
View identifiers
Classification
Uncertain significance
Variant description:
No variant summary was recorded for this case.
Five-step scale from benign to pathogenic. This variant is uncertain. Select a step to read what it means.
Uncertain.The recorded classification is uncertain significance.
In plain language
Gene-level background from the recorded interpretation.
Words with a dotted underline have a short definition. Hover or tap them.
LYFE Sciences is an AI system, and it can make mistakes.
Criteria may be applied incorrectly, sources may be misread, and a
confident-looking classification can still be wrong.
Double-check every criterion and its underlying evidence
before relying on any call.
01The reasoning
How it was classified
The recorded framework is Not recorded. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.
Recorded applied criteria
The applied criteria and their strengths are shown as assessed under the stated framework.
Pathogenic evidence criteria: 1
Benign evidence criteria: 0
Pathogenic criteria applied · 1
PM4Moderate
PM4 · moderate
NM_003016.4:c.284_307del is an in-frame deletion of 24 nucleotides, resulting in loss of 8 amino acids (Pro95 through Arg102) without disruption of the reading frame. The deletion spans a non-repetitive region at the boundary of the RRM domain and the RS-rich domain. Per ACMG/AMP 2015 (PMID:25741868), in-frame deletions in non-repeat regions meet PM4 at moderate strength.
Benign criteria applied · 0
No benign criterion marked as applied in the recorded assessment.
Recorded classification: Uncertain significance
gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PM4 moderate; combination = 1 moderate, which maps to VUS.
02The sources
Evidence at a glance
Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.
No screenshot for this evidence
Population frequency
Not recorded
gnomAD v4.1 allele counts were not recorded for this variant.
No listed criterion applied
gnomAD-Canada ↗
No screenshot for this evidence
Computational predictions
Not recorded
No SpliceAI or REVEL score is recorded in the fields used for this tile.
No listed criterion applied
No screenshot for this evidence
ClinVar submissions
Not recorded
A ClinVar laboratory submission summary was not recorded.
Context only
No screenshot for this evidence
Functional evidence
Not recorded
No standalone functional evidence summary is recorded in evidence_summary.functional.
No listed criterion applied
No screenshot for this evidence
Somatic evidence
Not assessed
No COSMIC evidence statement is recorded in this case.
Context only
For specialists
Technical detail
ACMG/AMP criteria under Not recorded, with the data and sources behind each one.
28 criteria with recorded statuses: 1 met · 3 not met · 15 not assessed · 9 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.
Met
Not met
Not assessed
Not applicable
NM_003016.4:c.284_307del is an in-frame deletion of 24 nucleotides in SRSF2, resulting in loss of 8 amino acids (p.Pro95_Arg102del) at the boundary of the RRM and RS-rich domains.
The deletion meets PM4 (moderate) because it causes a protein length change through an in-frame deletion in a non-repetitive region, per ACMG/AMP 2015 guidelines.
BP3 is not met because the deleted region is non-repetitive and includes Pro95, a residue of established functional significance in SRSF2.
PVS1 is not applicable: the variant is an in-frame deletion rather than a null variant. Per ClinGen SVI PVS1 recommendations, in-frame deletions are not eligible for PVS1 at any strength level.
Population frequency data from gnomAD v2.1 and v4.1 are unavailable due to incomplete variant normalization in the pipeline. gnomAD-Canada reports AC=0, AN=0 (no data), precluding application of PM2, BA1, or BS1.
Pro95 is a known somatic mutational hotspot in SRSF2 (ClinVar: P95H Pathogenic, P95L Pathogenic, P95R Likely pathogenic), but germline hotspot evidence for SRSF2 is not established, so PM1 is not met in this context.
Multiple criteria (PS2, PS3, PS4, PM6, PP1, PP4, BS2, BS3, BS4, BP2, BP5, BP6) remain not_assessed due to absence of case-level, functional, segregation, or population data in the available evidence.
Based on available evidence, the only applicable criterion is PM4 (moderate). The evidence is insufficient to reach a definitive classification; the variant defaults to Variant of Uncertain Significance (VUS) under generic ACMG/AMP 2015 combination rules.
No criteria match.
Met · 1
PM4 ModerateNM_003016.4:c.284_307del is an in-frame deletion of 24 nucleotides, resulting in loss of 8 amino acids (Pro95 through Arg102) without disruption of the reading frame. The deletion spans a non-repetitive region at the boundary of the RRM domain and the RS-rich domain. Per ACMG/AMP 2015 (PMID:25741868), in-frame deletions in non-repeat regions meet PM4 at moderate strength. Details ▾Hide ▴
Evidence considered
- In-frame deletion of 24 bp (c.284_307del) removing 8 amino acids (Pro95_Arg102del). Region is non-repetitive
- spans RRM-domain boundary. Mutalyzer confirms protein consequence.
Sources
generic_acmg_combination_rules
Not met · 3 · evaluated, threshold not reached
PM1 The deletion removes Pro95, a residue that is a well-known somatic mutational hotspot in SRSF2 for myeloid malignancies (P95H, P95L, P95R are classified as Pathogenic/Likely pathogenic in ClinVar). However, PM1 in the germline ACMG/AMP framework requires evidence that the variant lies within a recognized germline mutational hotspot or critical functional domain established for the associated disease. The Cancer Hotspots database did not flag this exact variant, and no germline-specific hotspot evidence was retrieved. Details ▾Hide ▴
Evidence considered
- Pro95 is a known somatic hotspot in SRSF2 (ClinVar: P95H Pathogenic
- P95L Pathogenic
- P95R Likely pathogenic)
- but germline hotspot evidence is not established. Cancer Hotspots: exact variant not listed.
Still missing
- No germline-specific mutational hotspot data for SRSF2. The known hotspot is in the somatic/oncogenic context.
Sources
generic_acmg_combination_rules
PP5 PP5 requires that a reputable source (e.g., clinical diagnostic laboratory) has reported the variant as pathogenic. No ClinVar entry was found for this variant, and no other reputable source reporting was identified. Details ▾Hide ▴
Evidence considered
- No ClinVar entry for this variant. No diagnostic laboratory reports available.
BP3 BP3 applies to in-frame deletions in repetitive regions without known function. The deletion removes residues Pro95 through Arg102 in SRSF2. This region is not repetitive, and Pro95 is a well-established functional residue (somatic hotspot in myeloid malignancies). The RRM/RS-domain boundary region has known functional significance. Details ▾Hide ▴
Evidence considered
- Deletion spans non-repetitive region. Pro95 is a known functional hotspot residue in SRSF2. Region includes RRM domain boundary.
Sources
generic_acmg_combination_rules
Not assessed · 15 · no assessment recorded
PS2 No de novo occurrence data available for this variant. PS2 requires confirmed de novo observation in a patient with disease and no family history. Details ▾Hide ▴
Still missing
- No de novo testing data or family studies available for this variant.
PS3 No functional studies evaluating this specific in-frame deletion were identified in the case evidence. Details ▾Hide ▴
Still missing
- No in vitro or in vivo functional assay data for NM_003016.4:c.284_307del.
PS4 No case-control or cohort data comparing variant prevalence in affected versus unaffected individuals were identified. Details ▾Hide ▴
Still missing
- No case-control data available. No affected individual counts.
PM2 gnomAD v2.1 and v4.1 population frequency data are not available (null values in evidence_brief). gnomAD-Canada reports AC=0, AN=0, indicating absence of data rather than confirmed absence from population. PM2 cannot be applied without valid population allele frequency data. Details ▾Hide ▴
Evidence considered
- gnomAD v2.1: no data. gnomAD v4.1: no data. gnomAD-Canada: AC=0
- AN=0 (no data).
Still missing
- Population frequency data from gnomAD v2.1 and v4.1 unavailable. Variant normalization failed in pipeline
- so genomic coordinate-based queries could not be performed.
PM6 No de novo occurrence data available. PM6 requires a de novo observation without confirmed maternity/paternity. Details ▾Hide ▴
Still missing
- No de novo data available.
PP1 No co-segregation data available for this variant. Details ▾Hide ▴
Still missing
- No family segregation data available.
PP4 No patient phenotype or family history information was provided for this case. Details ▾Hide ▴
Still missing
- No patient phenotype or clinical indication provided.
BA1 BA1 requires an allele frequency >1% in a general population database. gnomAD v2.1 and v4.1 data are unavailable (null). Cannot assess BA1 without population frequency data. Details ▾Hide ▴
Evidence considered
- gnomAD v2.1: no data. gnomAD v4.1: no data.
Still missing
- Population frequency data unavailable.
BS1 BS1 requires an allele frequency >0.3% in a general population database. gnomAD v2.1 and v4.1 data are unavailable. Cannot assess BS1 without population frequency data. Details ▾Hide ▴
Evidence considered
- gnomAD v2.1: no data. gnomAD v4.1: no data.
Still missing
- Population frequency data unavailable.
BS2 No data on observation in healthy adults (homozygous state or in trans with a pathogenic variant) was identified. Details ▾Hide ▴
Still missing
- No data on homozygous or compound heterozygous observations.
BS3 No well-established functional studies showing no damaging effect for this specific variant were identified. Details ▾Hide ▴
Still missing
- No functional studies available for this variant.
BS4 No segregation data in affected families is available to evaluate lack of segregation. Details ▾Hide ▴
Still missing
- No family segregation data available.
BP2 No data on observation in trans with a known pathogenic variant was identified. Details ▾Hide ▴
Still missing
- No in trans observation data available.
BP5 BP5 requires observation of the variant in a case where an alternate molecular basis for disease has been identified. No such data are available. Details ▾Hide ▴
Still missing
- No data on alternate molecular diagnoses in carriers.
BP6 BP6 requires a reputable source to have reported the variant as benign. No ClinVar entry or diagnostic laboratory report was identified for this variant. Details ▾Hide ▴
Still missing
- No reputable source reports available.
Not applicable · 9· recorded as not applicable Show reasons ▾Hide reasons ▴
PVS1 N/APVS1 is reserved for null variants (nonsense, frameshift, canonical splice, initiation codon, single/multi-exon deletions). NM_003016.4:c.284_307del is an in-frame deletion of 24 bp resulting in p.(Pro95_Arg102del), which does not trigger nonsense-mediated decay or abolish gene function through a null mechanism. Per ClinGen SVI PVS1 recommendations (PMC6185798), in-frame deletions are not eligible for PVS1 at any strength. Details ▾Hide ▴
Evidence considered
- Variant is an in-frame deletion (24 bp
- 8 amino acids). Mutalyzer confirms protein consequence as p.(Pro95_Arg102del). No null effect expected.
Sources
PS1 N/APS1 applies when a variant produces the same amino acid change as a previously established pathogenic missense variant. This variant is an in-frame deletion of 8 amino acids, not a single amino acid substitution. Details ▾Hide ▴
Evidence considered
- In-frame deletion of 8 residues (Pro95-Arg102)
- not a missense change eligible for PS1.
PM5 N/APM5 applies to a novel missense variant occurring at the same amino acid residue as a previously established pathogenic missense change. This variant is an in-frame deletion, not a missense substitution. Details ▾Hide ▴
Evidence considered
- In-frame deletion
- not a missense variant. PM5 missense-at-same-residue logic does not apply.
PP2 N/APP2 applies to missense variants in genes where missense variants are a common disease mechanism and benign missense variation is rare. This variant is an in-frame deletion, not a missense substitution. Details ▾Hide ▴
Evidence considered
- In-frame deletion
- not a missense variant.
PP3 N/APP3 relies on in silico missense prediction tools (REVEL, BayesDel, etc.) and/or SpliceAI scores. These tools are designed for single-nucleotide missense variants or splice-site variants and are not validated for in-frame deletions. No SpliceAI delta score is available for this variant. Details ▾Hide ▴
Evidence considered
- REVEL: not applicable (deletion
- not SNV). BayesDel: not applicable (deletion
- not SNV). SpliceAI: no score available.
BP1 N/ABP1 applies to missense variants in genes where the primary disease mechanism is truncating/loss-of-function. This variant is an in-frame deletion, not a missense substitution. Details ▾Hide ▴
Evidence considered
- In-frame deletion
- not a missense variant.
BP4 N/ABP4 relies on multiple lines of computational evidence (REVEL, BayesDel, SpliceAI, etc.) suggesting no impact. These tools are designed for missense or splice-site variants and are not validated for in-frame deletions. Details ▾Hide ▴
Evidence considered
- In silico prediction tools not applicable to in-frame deletions.
BP7 N/ABP7 applies to synonymous variants with no predicted splicing impact. This variant is an in-frame deletion, not a synonymous substitution. Details ▾Hide ▴
Evidence considered
- In-frame deletion
- not a synonymous variant.
PS5 N/APS5 is not a standard ACMG/AMP 2015 criterion. It is used only in certain VCEP/CSPEC frameworks; this case uses generic ACMG/AMP rules. Details ▾Hide ▴
No further detail was recorded.
Identifiers
- Coding (HGVS c.)
- NM_003016.4:c.284_307delCCCCCGGACTCACACCACAGCCGC
gnomAD v4.1
Allele count data not recorded
gnomAD v2.1
Allele count data not recorded
gnomAD-Canada v1.0
0 / 0 alleles
AF 0 · 0 homozygotes · FAF 0
By genetic ancestry
gnomAD-Canada
AF 0 · 0 / 0 alleles · 0 hom
Statements
No population statements were recorded.
Other predictors
- REVEL
- Not available
- BayesDel
- Not available
How the predictions were used
PP3 N/APP3 relies on in silico missense prediction tools (REVEL, BayesDel, etc.) and/or SpliceAI scores. These tools are designed for single-nucleotide missense variants or splice-site variants and are not validated for in-frame deletions. No SpliceAI delta score is available for this variant. Details ▾Hide ▴
Evidence considered
- REVEL: not applicable (deletion
- not SNV). BayesDel: not applicable (deletion
- not SNV). SpliceAI: no score available.
BP4 N/ABP4 relies on multiple lines of computational evidence (REVEL, BayesDel, SpliceAI, etc.) suggesting no impact. These tools are designed for missense or splice-site variants and are not validated for in-frame deletions. Details ▾Hide ▴
Evidence considered
- In silico prediction tools not applicable to in-frame deletions.
BP7 N/ABP7 applies to synonymous variants with no predicted splicing impact. This variant is an in-frame deletion, not a synonymous substitution. Details ▾Hide ▴
Evidence considered
- In-frame deletion
- not a synonymous variant.
0 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata.