FLT3c.1732_1797dupLikely pathogenic

Print report

Variant interpretation report

FLT3 c.1732_1797dup, p.(Met578_Tyr599dup)

NM_004119.2:c.1732_1797dup NP_004110.2:p.(Met578_Tyr599dup) View identifiers

Classification

Likely pathogenic

Variant description:

No variant summary was recorded for this case.

Five-step scale from benign to pathogenic. This variant is likely pathogenic. Select a step to read what it means.

Likely pathogenic.A likely pathogenic classification under the recorded framework.

In plain language

Gene-level background from the recorded interpretation.

About FLT3

No gene-level summary was recorded for this case.

Key facts

Evidence used: 3 moderate (pathogenic)
Expert rules: Local FLT3 ITD / activating length-mutation framework

Evidence considered

View criteria

Applied evidence criteria

PM1 (moderate): This variant is an in-frame tandem duplication, p.Met578_Tyr599dup, in the FLT3 juxtamembrane ITD hotspot region. The duplicated segment spans codons 578-599 and includes the classic activating codon 589-599 cluster, where recurrent FLT3 ITDs have been reported; this supports PM1 at Moderate strength under the local FLT3 framework.
PM2 (moderate): This variant is absent from gnomAD v2.1 and absent from gnomAD v4.1, so the observed population frequency is 0, which is below the default PM2 rarity threshold of 0.1%. This rarity supports PM2.
PM5 (moderate): This variant is a novel in-frame FLT3 tandem duplication in the established juxtamembrane activating ITD hotspot class. The exact duplicated sequence has not been individually curated in ClinVar or OncoKB, but the event is an ITD-class analogue spanning the classic codon 589-599 hotspot, where pathogenic/oncogenic FLT3 ITDs and activating length mutations are already established; this meets the local FLT3-specific PM5 rule at Moderate strength.

LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.

01The reasoning

How it was classified

The recorded framework is Local FLT3 ITD / activating length-mutation framework. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.

Recorded applied criteria

The applied criteria and their strengths are shown as assessed under the stated framework.

Pathogenic evidence criteria: 3 Benign evidence criteria: 0

Pathogenic criteria applied · 3

PM1Moderate

PM1 · moderate

This variant is an in-frame tandem duplication, p.Met578_Tyr599dup, in the FLT3 juxtamembrane ITD hotspot region. The duplicated segment spans codons 578-599 and includes the classic activating codon 589-599 cluster, where recurrent FLT3 ITDs have been reported; this supports PM1 at Moderate strength under the local FLT3 framework.

PM2Moderate

PM2 · moderate

This variant is absent from gnomAD v2.1 and absent from gnomAD v4.1, so the observed population frequency is 0, which is below the default PM2 rarity threshold of 0.1%. This rarity supports PM2.

PM5Moderate

PM5 · moderate

This variant is a novel in-frame FLT3 tandem duplication in the established juxtamembrane activating ITD hotspot class. The exact duplicated sequence has not been individually curated in ClinVar or OncoKB, but the event is an ITD-class analogue spanning the classic codon 589-599 hotspot, where pathogenic/oncogenic FLT3 ITDs and activating length mutations are already established; this meets the local FLT3-specific PM5 rule at Moderate strength.

Benign criteria applied · 0

No benign criterion marked as applied in the recorded assessment.

Recorded classification: Likely pathogenic

Applied the Local FLT3 ITD / activating length-mutation framework from final_classification_framework.json; this framework retains ACMG/AMP 2015 final category thresholds while using FLT3-specific criterion specifications.

02The sources

Evidence at a glance

Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.

gnomAD v4.1

gnomAD v2.1

Population frequency

Not recorded

gnomAD v4.1 allele counts were not recorded for this variant.

gnomAD v2.1

Absent from gnomAD v2.1.

Applied · PM2 →

gnomAD v4.1 ↗gnomAD v2.1 ↗

No screenshot for this evidence

Computational predictions

Not recorded

No SpliceAI or REVEL score is recorded in the fields used for this tile.

No listed criterion applied

ClinVar submissions

Not recorded

A ClinVar laboratory submission summary was not recorded.

Context only ClinVar ↗

Functional evidence

Statement recorded

OncoKB oncogenicity for this specific variant: not classified (variant has not been individually curated).

No listed criterion applied OncoKB ↗

COSMIC

Cancer Hotspots

Somatic evidence

Not assessed

No COSMIC evidence statement is recorded in this case.

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.

Context only

COSMIC ↗Cancer Hotspots ↗

For specialists

Technical detail

ACMG/AMP criteria under Local FLT3 ITD / activating length-mutation framework, with the data and sources behind each one.

28 criteria with recorded statuses: 3 met · 5 not met · 13 not assessed · 7 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.

Pathogenic

PVS1 PS1 PS2 PS3 PS4 PM1 PM2 PM3 PM4 PM5 PM6 PP1 PP2 PP3 PP4 PP5

Benign

BA1 BS1 BS2 BS3 BS4 BP1 BP2 BP3 BP4 BP5 BP6 BP7

Met Not met Not assessed Not applicable

The FLT3 c.1732_1797dup (p.Met578_Tyr599dup) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar.

This variant is absent from gnomAD v2.1 and gnomAD v4.1, with an observed population frequency of 0, which is below the default PM2 rarity threshold of 0.1%.

The duplicated segment spans the FLT3 juxtamembrane ITD hotspot and includes the classic codon 589-599 activating cluster, which supports hotspot-class evidence, but no exact-variant OncoKB functional assertion was identified for p.Met578_Tyr599dup.

SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.18.

Met · 3

PM1 ModerateThis variant is an in-frame tandem duplication, p.Met578_Tyr599dup, in the FLT3 juxtamembrane ITD hotspot region. The duplicated segment spans codons 578-599 and includes the classic activating codon 589-599 cluster, where recurrent FLT3 ITDs have been reported; this supports PM1 at Moderate strength under the local FLT3 framework. Details ▾Hide ▴

Rule

Apply PM1_Moderate to an in-frame FLT3 internal tandem duplication that maps to the juxtamembrane activating hotspot region, especially codons 589-599.

Evidence considered

Mutalyzer/VariantValidator normalized the event as a duplicated reference interval
protein consequence p.(Met578_Tyr599dup) in exon 14 juxtamembrane region
local FLT3 framework defines codons 589-599 as the canonical activating hotspot

Sources

prefetchvcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_nPMID:9737679 ↗PMID:11090077 ↗PMID:11756186 ↗

PM2 ModerateThis variant is absent from gnomAD v2.1 and absent from gnomAD v4.1, so the observed population frequency is 0, which is below the default PM2 rarity threshold of 0.1%. This rarity supports PM2. Details ▾Hide ▴

Rule

Default rarity threshold used: PM2 when population frequency is <0.1%.

Evidence considered

gnomAD v2.1: absent
gnomAD v4.1: absent

Sources

gnomad_v2 ↗gnomad_v4 ↗

PM5 ModerateThis variant is a novel in-frame FLT3 tandem duplication in the established juxtamembrane activating ITD hotspot class. The exact duplicated sequence has not been individually curated in ClinVar or OncoKB, but the event is an ITD-class analogue spanning the classic codon 589-599 hotspot, where pathogenic/oncogenic FLT3 ITDs and activating length mutations are already established; this meets the local FLT3-specific PM5 rule at Moderate strength. Details ▾Hide ▴

Rule

Apply PM5_Moderate to a novel FLT3 in-frame internal tandem duplication or activating length mutation in the established juxtamembrane ITD hotspot class, particularly codons 589-599.

Evidence considered

Variant absent from ClinVar
OncoKB did not identify exact-variant curation
local FLT3 framework extends PM5 to novel ITD / activating length-mutation events in the same established hotspot class

Sources

clinvar ↗oncokb ↗vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_nvcep_f_l_t_3___o_n_c_o_k_b___g_u_i_d_a_n_c_ePMID:9737679 ↗PMID:11090077 ↗PMID:11756186 ↗PMID:12384447 ↗

Not met · 5 · evaluated, threshold not reached

PS3 Available evidence supports FLT3 internal tandem duplications as an activating variant class in the juxtamembrane region, but no exact-variant OncoKB assertion or variant-specific functional study was identified for p.Met578_Tyr599dup. Under the local FLT3 framework, class-level ITD mechanism alone does not meet PS3 for a novel exact event. Details ▾Hide ▴

Rule

Local FLT3 rule: do not apply PS3 when only class-level FLT3 ITD literature is available and there is no exact-variant OncoKB support or variant-specific functional evidence.

Evidence considered

OncoKB: variant not individually curated; biological effect unknown
local FLT3 ITD literature supports class-level constitutive activation only

Still missing

Exact-variant OncoKB gain-of-function/oncogenic curation or a variant-specific functional study would be needed.

Sources

oncokb ↗vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_nvcep_f_l_t_3___o_n_c_o_k_b___g_u_i_d_a_n_c_ePMID:9737679 ↗PMID:11090077 ↗PMID:11756186 ↗PMID:12384447 ↗

PM4 This variant causes an in-frame protein length change, but in the local FLT3 framework canonical juxtamembrane ITD evidence is already captured by PM1 and the FLT3-specific PM5 rule. Available evidence does not provide a separate non-overlapping rationale to apply PM4 independently. Details ▾Hide ▴

Rule

Do not apply PM4 separately for canonical FLT3 juxtamembrane ITD / activating length-mutation events when PM1 and/or custom PM5 already capture the hotspot mechanism.

Evidence considered

local FLT3 framework advises against separately stacking PM4 for canonical juxtamembrane ITDs

Sources

vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_n

BA1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed population frequency is 0 and well below the BA1 threshold of 1%. BA1 is not met. Details ▾Hide ▴

Rule

BA1 default threshold >1%.

Evidence considered

gnomAD v2.1: absent
gnomAD v4.1: absent

Sources

gnomad_v2 ↗gnomad_v4 ↗

BS1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed population frequency is 0 and below the BS1 threshold of 0.3%. BS1 is not met. Details ▾Hide ▴

Rule

BS1 default threshold >0.3%.

Evidence considered

gnomAD v2.1: absent
gnomAD v4.1: absent

Sources

gnomad_v2 ↗gnomad_v4 ↗

BP3 This variant is an in-frame duplication in the established FLT3 juxtamembrane activating hotspot region, not a benign repeat-region event without known function. Under the local FLT3 framework, BP3 should not be applied to canonical juxtamembrane ITDs. Details ▾Hide ▴

Rule

Do not apply BP3 to FLT3 in-frame ITDs or activating length mutations in the juxtamembrane hotspot region.

Evidence considered

local FLT3 framework states BP3 is not applicable to juxtamembrane ITD hotspot events

Sources

vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_nPMID:9737679 ↗

Not assessed · 13 · no assessment recorded

PS2 No confirmed de novo data were identified, so PS2 was not assessed. Details ▾Hide ▴

Still missing

Parental testing or a documented de novo observation would be needed.

PS4 No case-control enrichment or case-series data demonstrating increased prevalence in affected individuals were identified, so PS4 was not assessed. Details ▾Hide ▴

Evidence considered

Variant absent from ClinVar
No COSMIC result found

Still missing

Published germline case-level enrichment data would be needed.

Sources

clinvar ↗cosmic ↗

PM3 No phase or recessive trans observations were identified, so PM3 was not assessed. Details ▾Hide ▴

Still missing

Phase information and a relevant recessive disease context would be needed.

PM6 No assumed de novo observation without confirmed maternity and paternity was identified, so PM6 was not assessed. Details ▾Hide ▴

Still missing

A documented assumed de novo observation would be needed.

PP1 No segregation data were identified, so PP1 was not assessed. Details ▾Hide ▴

Still missing

Family segregation data would be needed.

PP4 No phenotype-specific clinical data were identified to assess whether the presentation is highly specific for a FLT3-related germline disorder, so PP4 was not assessed. Details ▾Hide ▴

Still missing

Phenotype and family history data would be needed.

PP5 No reputable external pathogenic classification was identified because this variant is absent from ClinVar, so PP5 was not assessed. Details ▾Hide ▴

Evidence considered

Variant absent from ClinVar

Still missing

A reputable external pathogenic assertion for this exact variant would be needed.

Sources

clinvar ↗

BS2 No data were identified showing this variant in healthy adult individuals in a context sufficient for BS2, so BS2 was not assessed. Details ▾Hide ▴

Still missing

Well-documented observation in unaffected individuals would be needed.

BS3 No well-established functional study demonstrating a benign effect for this exact variant was identified, so BS3 was not assessed. Details ▾Hide ▴

Evidence considered

No exact-variant benign functional assertion identified

Still missing

A validated study showing no damaging effect for this exact variant would be needed.

Sources

oncokb ↗

BS4 No nonsegregation data were identified, so BS4 was not assessed. Details ▾Hide ▴

Still missing

Family nonsegregation data would be needed.

BP2 No phase data with another pathogenic variant were identified, so BP2 was not assessed. Details ▾Hide ▴

Still missing

Phase information with another variant would be needed.

BP5 No alternate molecular explanation for the phenotype was identified, so BP5 was not assessed. Details ▾Hide ▴

Still missing

Comprehensive clinical and molecular context would be needed.

BP6 No reputable external benign classification was identified because this variant is absent from ClinVar, so BP6 was not assessed. Details ▾Hide ▴

Evidence considered

Variant absent from ClinVar

Still missing

A reputable external benign assertion for this exact variant would be needed.

Sources

clinvar ↗

Not applicable · 7· recorded as not applicable Show reasons ▾Hide reasons ▴

PVS1 N/AThis variant is an in-frame duplication, NM_004119.2:c.1732_1797dup (p.Met578_Tyr599dup), and does not fall into the generic PVS1 null-variant categories of nonsense, frameshift, or canonical ±1,2 splice variants. Although FLT3 loss of function can be a germline disease mechanism, available evidence does not support applying PVS1 to this non-null variant type. Details ▾Hide ▴

Rule

Generic PVS1 fallback applies only to eligible null-variant classes; this variant is outside those classes.

Evidence considered

FLT3 loss-of-function mechanism supported at gene level
generic PVS1 scaffold marked apply_generic_pvs1_framework=false for this in-frame duplication

Sources

pvs1_gene_contextpvs1_variant_assessmentPMID:32581359 ↗PMID:35671390 ↗PMID:37681415 ↗PMID:39822584 ↗PMID:40568716 ↗

PS1 N/AThis variant is an in-frame duplication rather than a single-nucleotide missense substitution, so PS1 is not applicable. Details ▾Hide ▴

Evidence considered

protein consequence p.(Met578_Tyr599dup)

Sources

prefetch

PP2 N/APP2 is a missense-specific criterion and is not applicable to this in-frame duplication. Details ▾Hide ▴

Evidence considered

protein consequence p.(Met578_Tyr599dup)

Sources

prefetch

PP3 N/AMissense computational predictors are not applicable to this in-frame duplication. SpliceAI predicts no significant splice impact, with a maximum delta score of 0.18, but this does not provide pathogenic computational support for PP3. Details ▾Hide ▴

Evidence considered

SpliceAI max delta score 0.18

Sources

spliceai ↗

BP1 N/ABP1 is intended for missense variants in genes where truncating variants are the primary disease mechanism and is not applicable to this in-frame duplication. Details ▾Hide ▴

Evidence considered

protein consequence p.(Met578_Tyr599dup)

Sources

prefetch

BP4 N/AMissense computational predictors are not applicable to this in-frame duplication. SpliceAI predicts no significant splice impact, with a maximum delta score of 0.18, but that isolated finding does not support BP4 for a protein-altering tandem duplication. Details ▾Hide ▴

Evidence considered

SpliceAI max delta score 0.18

Sources

spliceai ↗

BP7 N/ABP7 is intended for synonymous variants with no predicted splice impact and is not applicable to this in-frame duplication. Details ▾Hide ▴

Evidence considered

protein consequence p.(Met578_Tyr599dup)
SpliceAI max delta score 0.18

Sources

prefetchspliceai ↗

Identifiers

Gene: FLT3
Transcript: NM_004119.2
Coding (HGVS c.): NM_004119.2:c.1732_1797dup
Protein (HGVS p.): NP_004110.2:p.(Met578_Tyr599dup)
GRCh38: chr13:28034121 C>CATATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGGTCACCTGTACCAT
GRCh37: chr13:28608258 C>CATATTCATATTCTCTGAAATCAACGTAGAAGTACTCATTATCTGAGGAGCCGGTCACCTGTACCAT

Gene diagram

Every interpreted variant in FLT3, mapped onto the exon structure of NM_004119.2. Select a row to find it on the plot.

FLT3NM_004119.2

Fetching transcript structure from UCSC…

Exons

—

Transcript span

—

Strand

—

Variants mapped

—

Source

UCSC ncbiRefSeqCurated

All variants in FLT3 — Select a row to find it on the plot; use the link to open its page.

	Protein	Location	Classification	Link

gnomAD v4.1 Allele count data not recorded

gnomAD v2.1 Allele count data not recorded

Statements

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

Other predictors

REVEL: Not available
BayesDel: Not available

How the predictions were used

Evidence considered

SpliceAI max delta score 0.18

Sources

spliceai ↗

Evidence considered

SpliceAI max delta score 0.18

Sources

spliceai ↗

BP7 N/ABP7 is intended for synonymous variants with no predicted splice impact and is not applicable to this in-frame duplication. Details ▾Hide ▴

Evidence considered

protein consequence p.(Met578_Tyr599dup)
SpliceAI max delta score 0.18

Sources

prefetchspliceai ↗

Statement

In silico

SpliceAI predicts no significant splice impact for this variant (max delta score = 0.18).

0 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata.

Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.

gnomAD v4.1 Captured gnomAD v4.1 source record Open source ↗

gnomAD v2.1 Captured gnomAD v2.1 source record Open source ↗

SpliceAI Lookup Captured SpliceAI source record Open source ↗

ClinVar Captured ClinVar source record Open source ↗

COSMIC Captured COSMIC source record Open source ↗

Cancer hotspots Captured Cancer Hotspots source record Open source ↗

OncoKB Captured OncoKB source record Open source ↗

All source links

Statements for reports

The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

ClinVar

This variant is absent from ClinVar.

In silico

SpliceAI predicts no significant splice impact for this variant (max delta score = 0.18).

Functional

OncoKB oncogenicity for this specific variant: not classified (variant has not been individually curated).

Somatic

This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.