FLT3c.1794_1795insACCATTGATTTCAGAGAATATGAALikely pathogenic

Print report

Variant interpretation report

FLT3 c.1794_1795insACCATTGATTTCAGAGAATATGAA, p.(Glu598_Tyr599insThrIleAspPheArgGluTyrGlu)

NM_004119.2:c.1794_1795insACCATTGATTTCAGAGAATATGAA NP_004110.2:p.(Glu598_Tyr599insThrIleAspPheArgGluTyrGlu) View identifiers

Classification

Likely pathogenic

Variant description:

No variant summary was recorded for this case.

Five-step scale from benign to pathogenic. This variant is likely pathogenic. Select a step to read what it means.

Likely pathogenic.A likely pathogenic classification under the recorded framework.

In plain language

Gene-level background from the recorded interpretation.

About FLT3

No gene-level summary was recorded for this case.

Key facts

Evidence used: 2 moderate (pathogenic) · 2 supporting (pathogenic)
Expert rules: Local FLT3 ITD / activating length-mutation framework

Evidence considered

View criteria

Applied evidence criteria

PS3 (supporting): OncoKB lists this exact FLT3 p.(Glu598_Tyr599insThrIleAspPheArgGluTyrGlu) variant as Likely Oncogenic with a Likely Gain-of-function effect, and published FLT3 ITD studies support constitutive activation for this mutation class. Under the local FLT3 framework, this supports PS3 at Supporting strength for an exact juxtamembrane ITD-like event.
PM1 (moderate): This in-frame FLT3 insertion affects the juxtamembrane hotspot at codons 598 to 599, within the established codon 589 to 599 activating ITD cluster. Published data showed 47 of 51 FLT3 ITDs localized to codons 589 to 599, supporting PM1_Moderate under the local FLT3 framework.
PM2 (supporting): This variant is absent from gnomAD v2.1 and gnomAD v4.1, which is below the default rarity threshold for PM2 (<0.1%). These population data support PM2 at Supporting strength.
PM5 (moderate): This novel in-frame FLT3 juxtamembrane insertion falls in the established activating ITD hotspot class at codons 598 to 599, where recurrent pathogenic or oncogenic FLT3 ITDs and activating length mutations are already established. Under the local FLT3 framework, this supports custom PM5_Moderate for a novel activating length-mutation analogue in the same hotspot mechanism class.

LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.

01The reasoning

How it was classified

The recorded framework is Local FLT3 ITD / activating length-mutation framework. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.

Recorded applied criteria

The applied criteria and their strengths are shown as assessed under the stated framework.

Pathogenic evidence criteria: 4 Benign evidence criteria: 0

Pathogenic criteria applied · 4

PS3Supporting

PS3 · supporting

OncoKB lists this exact FLT3 p.(Glu598_Tyr599insThrIleAspPheArgGluTyrGlu) variant as Likely Oncogenic with a Likely Gain-of-function effect, and published FLT3 ITD studies support constitutive activation for this mutation class. Under the local FLT3 framework, this supports PS3 at Supporting strength for an exact juxtamembrane ITD-like event.

PM1Moderate

PM1 · moderate

This in-frame FLT3 insertion affects the juxtamembrane hotspot at codons 598 to 599, within the established codon 589 to 599 activating ITD cluster. Published data showed 47 of 51 FLT3 ITDs localized to codons 589 to 599, supporting PM1_Moderate under the local FLT3 framework.

PM2Supporting

PM2 · supporting

This variant is absent from gnomAD v2.1 and gnomAD v4.1, which is below the default rarity threshold for PM2 (<0.1%). These population data support PM2 at Supporting strength.

PM5Moderate

PM5 · moderate

This novel in-frame FLT3 juxtamembrane insertion falls in the established activating ITD hotspot class at codons 598 to 599, where recurrent pathogenic or oncogenic FLT3 ITDs and activating length mutations are already established. Under the local FLT3 framework, this supports custom PM5_Moderate for a novel activating length-mutation analogue in the same hotspot mechanism class.

Benign criteria applied · 0

No benign criterion marked as applied in the recorded assessment.

Recorded classification: Likely pathogenic

Local FLT3 ITD / activating length-mutation framework (custom FLT3 criterion specifications with ACMG/AMP 2015 final category thresholds) from final_classification_framework.json.

02The sources

Evidence at a glance

Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.

gnomAD v4.1

gnomAD v2.1

Population frequency

Not recorded

gnomAD v4.1 allele counts were not recorded for this variant.

gnomAD v2.1

Absent from gnomAD v2.1.

Applied · PM2 →

gnomAD v4.1 ↗gnomAD v2.1 ↗

No screenshot for this evidence

Computational predictions

Not recorded

No SpliceAI or REVEL score is recorded in the fields used for this tile.

No listed criterion applied

ClinVar submissions

Not recorded

A ClinVar laboratory submission summary was not recorded.

Context only ClinVar ↗

Functional evidence

Statement recorded

OncoKB classifies this variant as Likely Oncogenic; biological effect: Likely Gain-of-function.

Applied · PS3 → OncoKB ↗

COSMIC

Cancer Hotspots

Somatic evidence

Not assessed

No COSMIC evidence statement is recorded in this case.

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.

Context only

COSMIC ↗Cancer Hotspots ↗

For specialists

Technical detail

ACMG/AMP criteria under Local FLT3 ITD / activating length-mutation framework, with the data and sources behind each one.

28 criteria with recorded statuses: 4 met · 5 not met · 12 not assessed · 7 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.

Pathogenic

PVS1 PS1 PS2 PS3 PS4 PM1 PM2 PM3 PM4 PM5 PM6 PP1 PP2 PP3 PP4 PP5

Benign

BA1 BS1 BS2 BS3 BS4 BP1 BP2 BP3 BP4 BP5 BP6 BP7

Met Not met Not assessed Not applicable

The FLT3 c.1794_1795insACCATTGATTTCAGAGAATATGAA (p.(Glu598_Tyr599insThrIleAspPheArgGluTyrGlu); p.(E598_Y599insTIDFREYE)) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar.

This variant is absent from gnomAD v2.1 and gnomAD v4.1, which is below the default PM2 population threshold of 0.1%.

This variant affects the established FLT3 juxtamembrane ITD hotspot at codons 598 to 599; published studies showed recurrent constitutive activation for FLT3 ITDs in the codon 589 to 599 cluster, and OncoKB classifies this exact variant as Likely Oncogenic with a Likely Gain-of-function effect.

SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.06.

Met · 4

PS3 SupportingOncoKB lists this exact FLT3 p.(Glu598_Tyr599insThrIleAspPheArgGluTyrGlu) variant as Likely Oncogenic with a Likely Gain-of-function effect, and published FLT3 ITD studies support constitutive activation for this mutation class. Under the local FLT3 framework, this supports PS3 at Supporting strength for an exact juxtamembrane ITD-like event. Details ▾Hide ▴

Rule

Local FLT3 framework PS3_Supporting for exact-variant OncoKB functional/mechanistic support plus class-level FLT3 ITD activation literature.

Evidence considered

OncoKB: Likely Oncogenic; biological effect: Likely Gain-of-function
FLT3 ITD literature supports constitutive activation and transformation

Sources

oncokb ↗vcep_f_l_t_3___o_n_c_o_k_b___g_u_i_d_a_n_c_evcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_nPMID:11090077 ↗PMID:11756186 ↗PMID:9737679 ↗

PM1 ModerateThis in-frame FLT3 insertion affects the juxtamembrane hotspot at codons 598 to 599, within the established codon 589 to 599 activating ITD cluster. Published data showed 47 of 51 FLT3 ITDs localized to codons 589 to 599, supporting PM1_Moderate under the local FLT3 framework. Details ▾Hide ▴

Rule

Local FLT3 framework PM1_Moderate for juxtamembrane ITD / activating length mutations, especially codons 589-599.

Evidence considered

Protein consequence p.(Glu598_Tyr599insThrIleAspPheArgGluTyrGlu)
Classic FLT3 ITD hotspot codons 589-599

Sources

vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_nPMID:9737679 ↗

PM2 SupportingThis variant is absent from gnomAD v2.1 and gnomAD v4.1, which is below the default rarity threshold for PM2 (<0.1%). These population data support PM2 at Supporting strength. Details ▾Hide ▴

Rule

Generic PM2 applied at Supporting strength for absence from population databases below 0.1%.

Evidence considered

Absent from gnomAD v2.1
Absent from gnomAD v4.1

Sources

gnomad_v2 ↗gnomad_v4 ↗

PM5 ModerateThis novel in-frame FLT3 juxtamembrane insertion falls in the established activating ITD hotspot class at codons 598 to 599, where recurrent pathogenic or oncogenic FLT3 ITDs and activating length mutations are already established. Under the local FLT3 framework, this supports custom PM5_Moderate for a novel activating length-mutation analogue in the same hotspot mechanism class. Details ▾Hide ▴

Rule

Local FLT3-specific PM5_Moderate extension for novel ITD / activating length mutation in established juxtamembrane hotspot class.

Evidence considered

Variant lies in codon 589-599 FLT3 ITD hotspot
ClinVar search found no exact prior submission
Published activating FLT3 length mutations support hotspot class mechanism

Sources

vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_nvcep_f_l_t_3___o_n_c_o_k_b___g_u_i_d_a_n_c_eclinvar ↗PMID:9737679 ↗PMID:12384447 ↗

Not met · 5 · evaluated, threshold not reached

BA1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, so its population frequency is well below the benign stand-alone threshold of 1% and BA1 is not met. Details ▾Hide ▴

Evidence considered

Absent from gnomAD v2.1
Absent from gnomAD v4.1

Sources

gnomad_v2 ↗gnomad_v4 ↗

BS1 This variant is absent from gnomAD v2.1 and gnomAD v4.1, so its population frequency is below the benign strong threshold of 0.3% and BS1 is not met. Details ▾Hide ▴

Evidence considered

Absent from gnomAD v2.1
Absent from gnomAD v4.1

Sources

gnomad_v2 ↗gnomad_v4 ↗

BS3 Available functional evidence does not show a normal or benign effect. Instead, OncoKB and the FLT3 ITD literature support an activating effect, so BS3 is not met. Details ▾Hide ▴

Evidence considered

OncoKB: Likely Oncogenic; Likely Gain-of-function
FLT3 ITD literature supports constitutive activation

Sources

oncokb ↗PMID:11090077 ↗PMID:11756186 ↗PMID:9737679 ↗

BP3 This in-frame insertion is located in the established FLT3 juxtamembrane activating hotspot, so the benign repetitive-region criterion BP3 should not be applied. Details ▾Hide ▴

Rule

Local FLT3 framework: BP3 not met for juxtamembrane hotspot ITD events.

Evidence considered

Local FLT3 framework states BP3 should not be used for juxtamembrane ITD / activating length mutations

Sources

vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_n

BP4 SpliceAI predicts no significant splice impact with a maximum delta score of 0.06, but that only argues against a splice-mediated mechanism and does not support a benign overall effect for this activating in-frame hotspot insertion. BP4 is therefore not met. Details ▾Hide ▴

Evidence considered

SpliceAI max delta score 0.06

Sources

spliceai ↗

Not assessed · 12 · no assessment recorded

PS2 No confirmed de novo data were identified, so PS2 cannot be assessed. Details ▾Hide ▴

Still missing

Parental testing and phenotype-confirmed de novo status

PS4 No germline case-control enrichment or statistically increased prevalence in affected individuals was identified, so PS4 cannot be assessed. Details ▾Hide ▴

Evidence considered

Variant absent from ClinVar and not found in COSMIC

Still missing

Germline case series or case-control data

Sources

clinvar ↗cosmic ↗

PM3 No data were identified about occurrence with another pathogenic variant in trans, so PM3 cannot be assessed. Details ▾Hide ▴

Still missing

Phasing and recessive inheritance data

PM6 No assumed de novo occurrence without confirmed parental testing was identified, so PM6 cannot be assessed. Details ▾Hide ▴

Still missing

De novo report without full parental confirmation

PP1 No segregation data were identified, so PP1 cannot be assessed. Details ▾Hide ▴

Still missing

Family segregation data

PP4 No phenotype information was provided to determine whether the clinical presentation is highly specific for a FLT3-related disorder, so PP4 cannot be assessed. Details ▾Hide ▴

Still missing

Detailed phenotype and disease context

PP5 No reputable external germline classification was identified, and PP5 is not used here. Details ▾Hide ▴

Evidence considered

Variant absent from ClinVar

Sources

clinvar ↗

BS2 No evidence was identified that this variant is observed in healthy adult individuals at a frequency inconsistent with disease, so BS2 cannot be assessed. Details ▾Hide ▴

Still missing

Observation in unaffected individuals with appropriate disease context

BS4 No segregation data showing lack of cosegregation with disease were identified, so BS4 cannot be assessed. Details ▾Hide ▴

Still missing

Family segregation data

BP2 No phase information with another variant was identified, so BP2 cannot be assessed. Details ▾Hide ▴

Still missing

Phase and second-variant data

BP5 No alternate molecular diagnosis was identified that would explain the phenotype independently of this variant, so BP5 cannot be assessed. Details ▾Hide ▴

Still missing

Independent alternate diagnosis data

BP6 No reputable external benign classification was identified, and BP6 is not used here. Details ▾Hide ▴

Evidence considered

Variant absent from ClinVar

Sources

clinvar ↗

Not applicable · 7· recorded as not applicable Show reasons ▾Hide reasons ▴

PVS1 N/AThis in-frame insertion does not create a nonsense, frameshift, or canonical +/-1,2 splice variant, and the generic PVS1 framework therefore does not apply. Details ▾Hide ▴

Rule

Generic PVS1 fallback withheld because apply_generic_pvs1_framework=false.

Evidence considered

NM_004119.2:c.1794_1795insACCATTGATTTCAGAGAATATGAA predicts p.(Glu598_Tyr599insThrIleAspPheArgGluTyrGlu)
Generic PVS1 scaffold states this variant is outside the default null-variant buckets

Sources

pvs1_variant_assessmentpvs1_gene_contextPMID:32581359 ↗

PS1 N/APS1 is intended for an alternate nucleotide change causing the same previously established amino acid substitution, which is not the mechanism for this in-frame insertion. Details ▾Hide ▴

Evidence considered

Variant is an in-frame insertion rather than a single amino acid substitution

PM4 N/AAlthough this is an in-frame length change, the local FLT3 framework advises not to apply PM4 separately for canonical juxtamembrane ITD or activating length-mutation events because the hotspot and mechanism are already captured by PM1 and custom PM5. Details ▾Hide ▴

Rule

Do not apply separately per local FLT3 framework.

Evidence considered

Local FLT3 framework explicitly advises against separate PM4 stacking in canonical FLT3 ITD setting

Sources

vcep_f_l_t_3___i_t_d___h_o_t_s_p_o_t___a_n_d___f_u_n_c_t_i_o_n

PP2 N/APP2 is intended for selected missense contexts and is not applicable to this in-frame insertion. Details ▾Hide ▴

Evidence considered

Variant is not missense

PP3 N/ANo validated in silico framework was identified for applying PP3 to this in-frame insertion. SpliceAI shows a low predicted splice effect with a maximum delta score of 0.06, which does not provide splice-based pathogenic computational support. Details ▾Hide ▴

Evidence considered

SpliceAI max delta score 0.06

Sources

spliceai ↗

BP1 N/ABP1 is intended for missense variants in genes where truncating variants are the primary disease mechanism and is not applicable to this in-frame insertion. Details ▾Hide ▴

Evidence considered

Variant is not missense

BP7 N/ABP7 applies to synonymous or certain noncoding variants with no predicted splice effect and is not applicable to this in-frame insertion. Details ▾Hide ▴

Evidence considered

Variant is not synonymous or intronic
SpliceAI max delta score 0.06

Sources

spliceai ↗

Identifiers

Gene: FLT3
Transcript: NM_004119.2
Coding (HGVS c.): NM_004119.2:c.1794_1795insACCATTGATTTCAGAGAATATGAA
Protein (HGVS p.): NP_004110.2:p.(Glu598_Tyr599insThrIleAspPheArgGluTyrGlu)
GRCh38: chr13:28034124 A>ATTCATATTCTCTGAAATCAATGGT
GRCh37: chr13:28608261 A>ATTCATATTCTCTGAAATCAATGGT

Gene diagram

Every interpreted variant in FLT3, mapped onto the exon structure of NM_004119.2. Select a row to find it on the plot.

FLT3NM_004119.2

Fetching transcript structure from UCSC…

Exons

—

Transcript span

—

Strand

—

Variants mapped

—

Source

UCSC ncbiRefSeqCurated

All variants in FLT3 — Select a row to find it on the plot; use the link to open its page.

	Protein	Location	Classification	Link

gnomAD v4.1 Allele count data not recorded

gnomAD v2.1 Allele count data not recorded

Statements

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

Other predictors

REVEL: Not available
BayesDel: Not available

How the predictions were used

Evidence considered

SpliceAI max delta score 0.06

Sources

spliceai ↗

Evidence considered

SpliceAI max delta score 0.06

Sources

spliceai ↗

BP7 N/ABP7 applies to synonymous or certain noncoding variants with no predicted splice effect and is not applicable to this in-frame insertion. Details ▾Hide ▴

Evidence considered

Variant is not synonymous or intronic
SpliceAI max delta score 0.06

Sources

spliceai ↗

Statement

In silico

SpliceAI predicts no significant splice impact for this variant (max delta score = 0.06).

0 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata.

Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.

gnomAD v4.1 Captured gnomAD v4.1 source record Open source ↗

gnomAD v2.1 Captured gnomAD v2.1 source record Open source ↗

SpliceAI Lookup Captured SpliceAI source record Open source ↗

ClinVar Captured ClinVar source record Open source ↗

COSMIC Captured COSMIC source record Open source ↗

Cancer hotspots Captured Cancer Hotspots source record Open source ↗

OncoKB Captured OncoKB source record Open source ↗

All source links

Statements for reports

The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

ClinVar

This variant is absent from ClinVar.

In silico

SpliceAI predicts no significant splice impact for this variant (max delta score = 0.06).

Functional

OncoKB classifies this variant as Likely Oncogenic; biological effect: Likely Gain-of-function.

Somatic

This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.