FLT3c.1835_1836insGGCTTGGGAGTTTCCAAGAGAAAATTTAGAGTTLikely pathogenic

Print report

Variant interpretation report

FLT3 c.1835_1836insGGCTTGGGAGTTTCCAAGAGAAAATTTAGAGTT, p.(Glu611_Phe612insLeuAlaTrpGluPheProArgGluAsnLeuGlu)

NM_004119.2:c.1835_1836insGGCTTGGGAGTTTCCAAGAGAAAATTTAGAGTT NP_004110.2:p.(Glu611_Phe612insLeuAlaTrpGluPheProArgGluAsnLeuGlu) View identifiers

Classification

Likely pathogenic

Variant description:

No variant summary was recorded for this case.

Five-step scale from benign to pathogenic. This variant is likely pathogenic. Select a step to read what it means.

Likely pathogenic.A likely pathogenic classification under the recorded framework.

In plain language

Gene-level background from the recorded interpretation.

About FLT3

No gene-level summary was recorded for this case.

Key facts

Evidence used: 2 moderate (pathogenic) · 2 supporting (pathogenic)
Expert rules: Local FLT3 ITD / activating length-mutation framework
Pipeline record: 27 May 2026

Evidence considered

View criteria

Applied evidence criteria

PS3 (supporting): The exact FLT3 p.(E611_F612insLAWEFPRENLE) event has a variant-specific curated OncoKB entry with Likely Gain-of-function and Likely Oncogenic annotations, and published studies of FLT3 internal tandem duplications showed constitutive activation, transforming activity, and myeloproliferative effects consistent with this established activating mechanism. In the local FLT3 framework, this supports PS3 at Supporting strength.
PM1 (moderate): Mutalyzer normalized this variant to NM_004119.2:c.1835_1836ins[GGCT;1807_1835], indicating duplication of a nearby reference interval consistent with an FLT3 internal tandem duplication. The protein consequence p.(E611_F612insLAWEFPRENLE) lies in the juxtamembrane region, and published FLT3 ITD data showed that the classic activating hotspot is centered in codons 589-599. In the local FLT3 framework, a juxtamembrane ITD/activating length-mutation event in this established hotspot mechanism meets PM1_Moderate.
PM2 (supporting): This variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0, so its observed population frequency is 0 and remains below the usual PM2 rarity threshold of 0.1%. This supports PM2 at Supporting strength.
PM5 (moderate): The local FLT3 framework uses a custom PM5 rule for novel in-frame internal tandem duplications and activating length mutations in the established juxtamembrane hotspot class rather than classic same-residue missense logic. This variant is an in-frame juxtamembrane ITD-class event, and published FLT3 literature has already established pathogenic/oncogenic activating length mutations in this hotspot mechanism. This supports PM5_Moderate under the local FLT3 framework.

LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.

01The reasoning

How it was classified

The recorded framework is Local FLT3 ITD / activating length-mutation framework. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.

Recorded applied criteria

The applied criteria and their strengths are shown as assessed under the stated framework.

Pathogenic evidence criteria: 4 Benign evidence criteria: 0

Pathogenic criteria applied · 4

PS3Supporting

PS3 · supporting

The exact FLT3 p.(E611_F612insLAWEFPRENLE) event has a variant-specific curated OncoKB entry with Likely Gain-of-function and Likely Oncogenic annotations, and published studies of FLT3 internal tandem duplications showed constitutive activation, transforming activity, and myeloproliferative effects consistent with this established activating mechanism. In the local FLT3 framework, this supports PS3 at Supporting strength.

PM1Moderate

PM1 · moderate

Mutalyzer normalized this variant to NM_004119.2:c.1835_1836ins[GGCT;1807_1835], indicating duplication of a nearby reference interval consistent with an FLT3 internal tandem duplication. The protein consequence p.(E611_F612insLAWEFPRENLE) lies in the juxtamembrane region, and published FLT3 ITD data showed that the classic activating hotspot is centered in codons 589-599. In the local FLT3 framework, a juxtamembrane ITD/activating length-mutation event in this established hotspot mechanism meets PM1_Moderate.

PM2Supporting

PM2 · supporting

This variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0, so its observed population frequency is 0 and remains below the usual PM2 rarity threshold of 0.1%. This supports PM2 at Supporting strength.

PM5Moderate

PM5 · moderate

The local FLT3 framework uses a custom PM5 rule for novel in-frame internal tandem duplications and activating length mutations in the established juxtamembrane hotspot class rather than classic same-residue missense logic. This variant is an in-frame juxtamembrane ITD-class event, and published FLT3 literature has already established pathogenic/oncogenic activating length mutations in this hotspot mechanism. This supports PM5_Moderate under the local FLT3 framework.

Benign criteria applied · 0

No benign criterion marked as applied in the recorded assessment.

Recorded classification: Likely pathogenic

Local FLT3 ITD / activating length-mutation framework (local-flt3-itd-framework-v1), which uses ACMG/AMP 2015 final category thresholds with custom FLT3 criterion specifications.

02The sources

Evidence at a glance

Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.

gnomAD v4.1

gnomAD v2.1

Population frequency

Not recorded

gnomAD v4.1 allele counts were not recorded for this variant.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

Applied · PM2 →

gnomAD v4.1 ↗gnomAD v2.1 ↗gnomAD-Canada ↗

SpliceAI score

0.090 maximum delta

Recorded SpliceAI maximum delta score: 0.090. Refer to the recorded PP3/BP4 rationale for interpretation.

No listed criterion applied SpliceAI ↗

ClinVar submissions

Not recorded

A ClinVar laboratory submission summary was not recorded.

Context only ClinVar ↗

Functional evidence

Statement recorded

OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Gain-of-function; curated oncogenicity label: Likely Oncogenic.

Applied · PS3 → OncoKB ↗

COSMIC

Cancer Hotspots

Somatic evidence

No matching record reported

This variant has not previously been reported in somatic cancers (COSMIC).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.

Context only

COSMIC ↗Cancer Hotspots ↗

For specialists

Technical detail

ACMG/AMP criteria under Local FLT3 ITD / activating length-mutation framework, with the data and sources behind each one.

28 criteria with recorded statuses: 4 met · 6 not met · 9 not assessed · 9 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.

Pathogenic

PVS1 PS1 PS2 PS3 PS4 PM1 PM2 PM3 PM4 PM5 PM6 PP1 PP2 PP3 PP4 PP5

Benign

BA1 BS1 BS2 BS3 BS4 BP1 BP2 BP3 BP4 BP5 BP6 BP7

Met Not met Not assessed Not applicable

The FLT3 c.1835_1836insGGCTTGGGAGTTTCCAAGAGAAAATTTAGAGTT (p.(E611_F612insLAWEFPRENLE)) variant has not been reported in ClinVar.

This variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0.

Mutalyzer normalization is consistent with an FLT3 internal tandem duplication, and published studies of FLT3 internal tandem duplications showed constitutive activation, transforming activity, and myeloproliferative effects; the exact p.(E611_F612insLAWEFPRENLE) event also has variant-specific curated evidence consistent with likely gain of function.

SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.09.

Met · 4

PS3 SupportingThe exact FLT3 p.(E611_F612insLAWEFPRENLE) event has a variant-specific curated OncoKB entry with Likely Gain-of-function and Likely Oncogenic annotations, and published studies of FLT3 internal tandem duplications showed constitutive activation, transforming activity, and myeloproliferative effects consistent with this established activating mechanism. In the local FLT3 framework, this supports PS3 at Supporting strength. Details ▾Hide ▴

Rule

Local FLT3 framework caps exact-variant OncoKB plus class-level ITD activation evidence at PS3_Supporting.

Evidence considered

Variant-specific OncoKB page reported Likely Gain-of-function and Likely Oncogenic.
Published FLT3 ITD studies showed constitutive activation and transforming behavior for this mutation class.

Still missing

No standalone exact-variant wet-lab assay report was identified.

Sources

oncokb ↗PMID:11090077 ↗PMID:11756186 ↗PMID:12384447 ↗PMID:9737679 ↗vcep_flt3_itd_hotspot_and_functionvcep_flt3_oncokb_guidance

PM1 ModerateMutalyzer normalized this variant to NM_004119.2:c.1835_1836ins[GGCT;1807_1835], indicating duplication of a nearby reference interval consistent with an FLT3 internal tandem duplication. The protein consequence p.(E611_F612insLAWEFPRENLE) lies in the juxtamembrane region, and published FLT3 ITD data showed that the classic activating hotspot is centered in codons 589-599. In the local FLT3 framework, a juxtamembrane ITD/activating length-mutation event in this established hotspot mechanism meets PM1_Moderate. Details ▾Hide ▴

Rule

Apply PM1_Moderate to juxtamembrane FLT3 ITD / activating length-mutation events in the established hotspot class.

Evidence considered

Normalized description showed duplicated reference sequence consistent with ITD-class event.
Protein effect is a juxtamembrane in-frame insertion.
FLT3 ITD hotspot literature supports this region as an established activating hotspot.

Sources

PMID:9737679 ↗PMID:11090077 ↗PMID:11756186 ↗vcep_flt3_itd_hotspot_and_function

PM2 SupportingThis variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0, so its observed population frequency is 0 and remains below the usual PM2 rarity threshold of 0.1%. This supports PM2 at Supporting strength. Details ▾Hide ▴

Evidence considered

Absent from gnomAD v2.1.
Absent from gnomAD v4.1.
Absent from gnomAD-Canada v1.0.

Sources

gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗

PM5 ModerateThe local FLT3 framework uses a custom PM5 rule for novel in-frame internal tandem duplications and activating length mutations in the established juxtamembrane hotspot class rather than classic same-residue missense logic. This variant is an in-frame juxtamembrane ITD-class event, and published FLT3 literature has already established pathogenic/oncogenic activating length mutations in this hotspot mechanism. This supports PM5_Moderate under the local FLT3 framework. Details ▾Hide ▴

Rule

Local FLT3-specific PM5 extension for novel ITD / activating length-mutation events in the established hotspot class.

Evidence considered

PM5 candidate artifact flagged that this case uses a custom length-mutation PM5 mode rather than classic same-residue missense PM5.
Local FLT3 framework allows PM5 for novel ITD/activating length-mutation analogues in the same hotspot class.

Still missing

The exact inserted sequence has not been independently established in ClinVar or classic same-residue comparator datasets.

Sources

pm5_candidatesPMID:9737679 ↗PMID:12384447 ↗vcep_flt3_itd_hotspot_and_functionvcep_flt3_oncokb_guidance

Not met · 6 · evaluated, threshold not reached

PP3 Computational evidence does not support a damaging splicing effect. SpliceAI showed a maximum delta score of 0.09, which is below commonly used splice-impact concern thresholds, and REVEL, BayesDel, and HCI prior scores are not applicable or not available for this non-SNV in-frame insertion. Therefore, PP3 is not met. Details ▾Hide ▴

Evidence considered

SpliceAI max delta score 0.09.
REVEL and BayesDel were skipped because this is not an SNV.
HCI prior was not available for FLT3.

Still missing

No validated protein-level computational predictor was available for this insertion.

Sources

spliceai ↗

BA1 This variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0, so it does not meet the BA1 stand-alone benign frequency threshold of greater than 1%. Details ▾Hide ▴

Evidence considered

Population frequency observed = 0.

Sources

gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗

BS1 This variant is absent from gnomAD v2.1, gnomAD v4.1, and gnomAD-Canada v1.0, so it does not exceed the BS1 benign frequency threshold of greater than 0.3%. Details ▾Hide ▴

Evidence considered

Population frequency observed = 0.

Sources

gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗

BS3 Available functional evidence does not show a benign or normal effect. Published FLT3 internal tandem duplication studies support an activating mechanism rather than a benign one, so BS3 is not met. Details ▾Hide ▴

Evidence considered

Class-level FLT3 ITD functional literature supports constitutive activation and transformation
not a benign effect.

Still missing

A well-established assay demonstrating no damaging effect would be needed for BS3.

Sources

PMID:11090077 ↗PMID:11756186 ↗PMID:12384447 ↗PMID:9737679 ↗vcep_flt3_itd_hotspot_and_function

BP3 BP3 should not be applied to FLT3 juxtamembrane internal tandem duplication or activating length-mutation events because this region has a known activating disease mechanism and recurrent pathogenic/oncogenic variation. Details ▾Hide ▴

Rule

Not met in canonical FLT3 juxtamembrane ITD setting.

Evidence considered

Local FLT3 framework specifically excludes BP3 for juxtamembrane ITD-class variants.

Sources

vcep_flt3_itd_hotspot_and_function

BP4 SpliceAI predicts no significant splice impact for this variant with a maximum delta score of 0.09, but this does not provide benign support for an in-frame juxtamembrane FLT3 insertion with an established activating protein-level mechanism. Therefore, BP4 is not met. Details ▾Hide ▴

Evidence considered

SpliceAI max delta score 0.09 indicates no major splice effect.

Still missing

No validated computational framework was available to support a benign protein-level interpretation for this insertion.

Sources

spliceai ↗

Not assessed · 9 · no assessment recorded

PS2 No confirmed de novo data were identified, so PS2 cannot be assessed. Details ▾Hide ▴

Still missing

Parental testing or a documented de novo occurrence would be needed.

PS4 No case-control or enrichment data comparing affected and unaffected individuals were identified, so PS4 was not assessed. Details ▾Hide ▴

Still missing

Robust germline case-enrichment data would be needed.

PM6 No assumed de novo data without confirmed parentage were identified, so PM6 was not assessed. Details ▾Hide ▴

Still missing

Documented de novo occurrence information would be needed.

PP1 No segregation data were identified, so PP1 cannot be assessed. Details ▾Hide ▴

Still missing

Family segregation data would be needed.

PP4 No specific germline phenotype or family-level clinical presentation was provided that would allow PP4 assessment. Details ▾Hide ▴

Still missing

Detailed phenotype and diagnostic specificity would be needed.

BS2 No evidence was identified showing this variant in a sufficient number of healthy adults for BS2 assessment. Details ▾Hide ▴

Still missing

Robust healthy-observation data would be needed.

BS4 No segregation data showing lack of cosegregation with disease were identified, so BS4 was not assessed. Details ▾Hide ▴

Still missing

Family segregation data would be needed.

BP2 No phase data with another pathogenic variant were identified, so BP2 was not assessed. Details ▾Hide ▴

Still missing

Phase information would be needed.

BP5 No alternate molecular explanation for a reported phenotype was identified, so BP5 was not assessed. Details ▾Hide ▴

Still missing

A confirmed alternate cause of disease would be needed.

Not applicable · 9· recorded as not applicable Show reasons ▾Hide reasons ▴

PVS1 N/AThis variant is an in-frame insertion and does not fall into the generic PVS1 null-variant categories of nonsense, frameshift, or canonical +/-1,2 splice variants, so PVS1 is not applicable. Details ▾Hide ▴

Rule

Generic PVS1 fallback not triggered for non-null in-frame insertion.

Evidence considered

Generic PVS1 scaffold did not support application for this in-frame insertion.

Sources

pvs1_gene_contextpvs1_variant_assessmentpvs1_generic_framework ↗

PS1 N/APS1 is intended for a variant that results in the same amino acid change as a previously established pathogenic variant. This in-frame insertion does not fit that rule. Details ▾Hide ▴

No further detail was recorded.

PM3 N/APM3 is used for recessive disorders with trans observations. No relevant recessive disease context or trans data were identified for this variant. Details ▾Hide ▴

No further detail was recorded.

PM4 N/AAlthough this is a protein-length change, the local FLT3 framework states that PM4 should not be applied separately for canonical juxtamembrane FLT3 internal tandem duplication or activating length-mutation events when PM1 and/or the custom PM5 rule already capture the hotspot and established activating mechanism. Details ▾Hide ▴

Rule

Do not apply separately.

Evidence considered

Local FLT3 framework advises against separate PM4 stacking for canonical juxtamembrane ITD-class events.

Sources

vcep_flt3_itd_hotspot_and_function

PP2 N/APP2 is a missense-specific criterion and is not applicable to this in-frame insertion. Details ▾Hide ▴

No further detail was recorded.

PP5 N/APP5 was not used. No ClinVar submission was identified for this variant, and reputable-source-only criteria are not relied on here. Details ▾Hide ▴

Evidence considered

No ClinVar result found.

Sources

clinvar ↗

BP1 N/ABP1 is a missense-specific criterion and is not applicable to this in-frame insertion. Details ▾Hide ▴

No further detail was recorded.

BP6 N/ABP6 was not used. No ClinVar submission was identified for this variant, and reputable-source-only benign criteria are not relied on here. Details ▾Hide ▴

Evidence considered

No ClinVar result found.

Sources

clinvar ↗

BP7 N/ABP7 is intended for synonymous or certain intronic variants without splice impact and is not applicable to this in-frame coding insertion. Details ▾Hide ▴

No further detail was recorded.

Identifiers

Gene: FLT3
Transcript: NM_004119.2
Coding (HGVS c.): NM_004119.2:c.1835_1836insGGCTTGGGAGTTTCCAAGAGAAAATTTAGAGTT
Protein (HGVS p.): NP_004110.2:p.(Glu611_Phe612insLeuAlaTrpGluPheProArgGluAsnLeuGlu)
GRCh38: chr13:28034083 A>AAACTCTAAATTTTCTCTTGGAAACTCCCAAGCC
GRCh37: chr13:28608220 A>AAACTCTAAATTTTCTCTTGGAAACTCCCAAGCC

Gene diagram

Every interpreted variant in FLT3, mapped onto the exon structure of NM_004119.2. Select a row to find it on the plot.

FLT3NM_004119.2

Fetching transcript structure from UCSC…

Exons

—

Transcript span

—

Strand

—

Variants mapped

—

Source

UCSC ncbiRefSeqCurated

All variants in FLT3 — Select a row to find it on the plot; use the link to open its page.

	Protein	Location	Classification	Link

gnomAD v4.1 Allele count data not recorded

gnomAD v2.1 Allele count data not recorded

gnomAD-Canada v1.0 Allele count data not recorded

Statements

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

SpliceAI and Pangolin

SpliceAI acceptor lossat -97 bp

0.060

SpliceAI acceptor gainat +51 bp

0.090

SpliceAI donor lossat +218 bp

0.010

SpliceAI donor gainat +124 bp

0.030

Pangolin splice lossmagnitude shown

-0.090

Pangolin splice gain

0.100

Other predictors

REVEL: Not available
BayesDel: Not available

How the predictions were used

Evidence considered

SpliceAI max delta score 0.09.
REVEL and BayesDel were skipped because this is not an SNV.
HCI prior was not available for FLT3.

Still missing

No validated protein-level computational predictor was available for this insertion.

Sources

spliceai ↗

Evidence considered

SpliceAI max delta score 0.09 indicates no major splice effect.

Still missing

No validated computational framework was available to support a benign protein-level interpretation for this insertion.

Sources

spliceai ↗

BP7 N/ABP7 is intended for synonymous or certain intronic variants without splice impact and is not applicable to this in-frame coding insertion. Details ▾Hide ▴

No further detail was recorded.

Statement

In silico

SpliceAI predicts no significant splice impact for this variant (max delta score = 0.09).

6 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata. None of the listed paper records explicitly indicates that the variant is named.

Recorded publications

Flt3 mutations from patients with acute myeloid leukemia induce transformation of 32D cells mediated by the Ras and STAT5 pathways.

No paper-specific finding is recorded.

PMID 11090077 ↗
FLT3 internal tandem duplication mutations associated with human acute myeloid leukemias induce myeloproliferative disease in a murine bone marrow transplant model.

No paper-specific finding is recorded.

PMID 11756186 ↗
A new and recurrent activating length mutation in exon 20 of the FLT3 gene in acute myeloid leukemia.

No paper-specific finding is recorded.

PMID 12384447 ↗
FLT3 tyrosine kinase inhibitors in acute myeloid leukemia: clinical implications and limitations.

No paper-specific finding is recorded.

PMID 23631653 ↗
Profiling of somatic mutations in acute myeloid leukemia with FLT3-ITD at diagnosis and relapse.

No paper-specific finding is recorded.

PMID 26438511 ↗
Internal tandem duplication of the FLT3 gene is a novel modality of elongation mutation which causes constitutive activation of the product.

No paper-specific finding is recorded.

PMID 9737679 ↗

Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.

gnomAD v4.1 Captured gnomAD v4.1 source record Open source ↗

gnomAD v2.1 Captured gnomAD v2.1 source record Open source ↗

SpliceAI Lookup Recorded maximum delta 0.090 Open source ↗

ClinVar Captured ClinVar source record Open source ↗

COSMIC Captured COSMIC source record Open source ↗

Cancer hotspots Captured Cancer Hotspots source record Open source ↗

OncoKB Captured OncoKB source record Open source ↗

All source links

Statements for reports

The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

ClinVar

This variant is absent from ClinVar.

In silico

SpliceAI predicts no significant splice impact for this variant (max delta score = 0.09).

Functional

OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Gain-of-function; curated oncogenicity label: Likely Oncogenic.

Somatic

This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.