0%
ARID1Ac.2378_2396delPathogenic
Print report
Variant interpretation report

ARID1A c.2378_2396del, p.(Met793ArgfsTer34)

NM_006015.5:c.2378_2396del NP_006006.3:p.(Met793ArgfsTer34) View identifiers
Classification
Pathogenic

Variant description:

No variant summary was recorded for this case.

Five-step scale from benign to pathogenic. This variant is pathogenic. Select a step to read what it means.

Pathogenic.A pathogenic classification under the recorded framework.

In plain language

Gene-level background from the recorded interpretation.

About ARID1A

No gene-level summary was recorded for this case.

LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
01The reasoning

How it was classified

The recorded framework is Not recorded. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.

Recorded applied criteria

The applied criteria and their strengths are shown as assessed under the stated framework.

Pathogenic evidence criteria: 3 Benign evidence criteria: 0
Pathogenic criteria applied · 3
PVS1Very strong
PVS1 · very strong

NM_006015.5:c.2378_2396del is a frameshift deletion predicted to result in a premature termination codon (p.Met793ArgfsTer34) in exon 7 of 20. The variant is predicted to undergo nonsense-mediated decay. ARID1A has an established loss-of-function disease mechanism supported by germline disease context literature (BAFopathies including Coffin-Siris syndrome, fetal hydrocephalus), and the gene is eligible for generic PVS1 assessment under PMC6185798. A newer transcript version NM_006015.6 exists but does not alter the null-effect assessment.

PM1Moderate
PM1 · moderate

NM_006015.5:c.2378_2396del introduces a frameshift at codon 793 (p.Met793ArgfsTer34) that truncates the ARID1A protein, removing approximately 65% of the coding sequence including all C-terminal functional domains. ARID1A is a well-characterized tumor suppressor and core component of the SWI/SNF chromatin remodeling complex (PMID:21900401, PMID:22009941). The truncation removes regions essential for SWI/SNF complex assembly and chromatin remodeling activity. The variant is absent from population databases, satisfying the requirement of no benign variation in the region.

PM2Supporting
PM2 · supporting

NM_006015.5:c.2378_2396del is absent from gnomAD v2.1 (exomes), gnomAD v4.1 (exomes), and gnomAD-Canada v1.0 (genomes). Under non-VCEP generic ACMG/AMP, PM2 is applied at supporting strength for variants with allele frequency below 0.1% in population databases.

Benign criteria applied · 0

No benign criterion marked as applied in the recorded assessment.

Recorded classification: Pathogenic

gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PVS1 very strong, PM1 moderate, PM2 supporting; combination = 1 very strong + 1 moderate + 1 supporting, which maps to Pathogenic.

02The sources

Evidence at a glance

Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.

SpliceAI score
0.160 maximum delta

Recorded SpliceAI maximum delta score: 0.160. Refer to the recorded PP3/BP4 rationale for interpretation.

No listed criterion applied SpliceAI ↗
ClinVar submissions
Not recorded

A ClinVar laboratory submission summary was not recorded.

Context only ClinVar ↗
Functional evidence
Statement recorded

OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.

No listed criterion applied OncoKB ↗
COSMIC
Cancer Hotspots
Somatic evidence
No matching record reported

This variant has not previously been reported in somatic cancers (COSMIC).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.

Context only
COSMIC ↗Cancer Hotspots ↗
For specialists

Technical detail

ACMG/AMP criteria under Not recorded, with the data and sources behind each one.

29 criteria with recorded statuses: 3 met · 17 not met · 0 not assessed · 9 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.

Pathogenic
PVS1PS1PS2PS3PS4PM1PM2PM3PM4PM5PM6PP1PP2PP3PP4PP5PS5
Benign
BA1BS1BS2BS3BS4BP1BP2BP3BP4BP5BP6BP7
Met Not met Not assessed Not applicable

NM_006015.5:c.2378_2396del (p.Met793ArgfsTer34) is a frameshift deletion predicted to undergo nonsense-mediated decay in ARID1A, a gene with an established loss-of-function disease mechanism associated with BAFopathies including Coffin-Siris syndrome. PVS1 is applied at very strong strength under the ClinGen SVI PVS1 framework (PMC6185798).

The variant truncates the ARID1A protein at codon 793, removing approximately 65% of the coding sequence including all C-terminal functional domains critical for SWI/SNF chromatin remodeling complex assembly and tumor suppression. PM1 is applied at moderate strength.

The variant is absent from all population databases including gnomAD v2.1, v4.1, and gnomAD-Canada. PM2 is applied at supporting strength.

No variant-specific functional studies, clinical case reports, segregation data, de novo observations, or ClinVar classifications are available for this variant. All reviewed publications discuss ARID1A at the gene level and do not mention NM_006015.5:c.2378_2396del.

Applying the ACMG/AMP 2015 combination rules: PVS1 (very strong) + PM1 (moderate) + PM2 (supporting) meets the pathogenic threshold (1 Very Strong + 1 Moderate + ≥1 Supporting). The variant is classified as Pathogenic.

Met · 3

PVS1 Very strongNM_006015.5:c.2378_2396del is a frameshift deletion predicted to result in a premature termination codon (p.Met793ArgfsTer34) in exon 7 of 20. The variant is predicted to undergo nonsense-mediated decay. ARID1A has an established loss-of-function disease mechanism supported by germline disease context literature (BAFopathies including Coffin-Siris syndrome, fetal hydrocephalus), and the gene is eligible for generic PVS1 assessment under PMC6185798. A newer transcript version NM_006015.6 exists but does not alter the null-effect assessment. Details ▾Hide ▴
Evidence considered
  • Frameshift deletion c.2378_2396del in exon 7/20
  • predicted NMD
  • ARID1A LoF mechanism supported by germline disease literature (BAFopathies
  • Coffin-Siris syndrome)
  • PVS1 gene gate: eligible per PMC6185798 generic framework
Still missing
  • Transcript NM_006015.6 is the current RefSeq version
  • NM_006015.5 remains valid but should be confirmed
Sources
pvs1_generic_framework ↗pvs1_gene_contextpvs1_variant_assessment
PM1 ModerateNM_006015.5:c.2378_2396del introduces a frameshift at codon 793 (p.Met793ArgfsTer34) that truncates the ARID1A protein, removing approximately 65% of the coding sequence including all C-terminal functional domains. ARID1A is a well-characterized tumor suppressor and core component of the SWI/SNF chromatin remodeling complex (PMID:21900401, PMID:22009941). The truncation removes regions essential for SWI/SNF complex assembly and chromatin remodeling activity. The variant is absent from population databases, satisfying the requirement of no benign variation in the region. Details ▾Hide ▴
Evidence considered
  • Frameshift at codon 793 truncates ARID1A
  • removing C-terminal SWI/SNF functional domains
  • ARID1A established as tumor suppressor with critical chromatin remodeling function (PMID:21900401)
  • Absent from gnomAD v2.1 and v4.1
Still missing
  • Domain mapping for residues beyond the ARID domain is functional but not crystallographically resolved
Sources
PMID:21900401 ↗PMID:22009941 ↗gnomad_v2 ↗gnomad_v4 ↗
PM2 SupportingNM_006015.5:c.2378_2396del is absent from gnomAD v2.1 (exomes), gnomAD v4.1 (exomes), and gnomAD-Canada v1.0 (genomes). Under non-VCEP generic ACMG/AMP, PM2 is applied at supporting strength for variants with allele frequency below 0.1% in population databases. Details ▾Hide ▴
Evidence considered
  • Absent from gnomAD v2.1 (0 alleles)
  • Absent from gnomAD v4.1 (0 alleles)
  • Absent from gnomAD-Canada v1.0 (0 alleles)
Sources
gnomad_v2 ↗gnomad_v4 ↗gnomad_canada ↗

Not met · 17 · evaluated, threshold not reached

PS2 No de novo observation has been reported for NM_006015.5:c.2378_2396del. The variant is absent from ClinVar and no publication reports a de novo event involving this variant. Details ▾Hide ▴
Still missing
  • No de novo testing data available for this variant
PS3 No variant-specific functional studies have been performed for NM_006015.5:c.2378_2396del (p.Met793ArgfsTer34). Four publications retrieved via OncoKB discuss ARID1A functional characterization at the gene level (tumor suppressor, SWI/SNF chromatin remodeling), but none tested or reported this exact variant. Domain-level inference from gene-level studies does not satisfy PS3's requirement for variant-specific or systematically characterized range-level functional evidence. Details ▾Hide ▴
Evidence considered
  • PMID:21900401: gene-level rescue experiments in ovarian cancer cell lines
  • no variant-specific data
  • PMID:22009941: pan-tumor mutational survey of ARID1A
  • no functional testing of c.2378_2396del
  • PMID:24899687: Arid1a conditional knockout mouse model
  • PMID:25625625: Arid1a-Pik3ca mouse model of OCCC
Still missing
  • No experimental functional data exists for this specific variant or a systematically characterized range that includes position 793
PS4 NM_006015.5:c.2378_2396del has not been reported in affected individuals. The variant is absent from ClinVar, COSMIC, and all reviewed publications. Details ▾Hide ▴
Still missing
  • No clinical case reports available
PM6 No de novo observation has been reported for NM_006015.5:c.2378_2396del. PM6 requires confirmed de novo status (both maternity and paternity confirmed). Details ▾Hide ▴
Still missing
  • No de novo testing data available
PP1 No segregation data are available for NM_006015.5:c.2378_2396del. No family studies have been reported for this variant in any publication reviewed. Details ▾Hide ▴
Still missing
  • No family segregation data available
PP3 SpliceAI predicts no significant splice impact for this variant (max delta score = 0.16, well below the 0.2 threshold). REVEL and BayesDel scores are not applicable to deletion variants. No in silico evidence supports a damaging effect. Details ▾Hide ▴
Evidence considered
  • SpliceAI max delta score: 0.16 (below threshold for splicing impact)
  • REVEL and BayesDel not applicable (not a single-nucleotide variant)
Still missing
  • No protein-level in silico predictors applicable to frameshift variants
Sources
spliceai ↗
PP4 No patient phenotype or family history data are available for this variant. PP4 requires a phenotype highly specific for the gene/disease with a single genetic etiology. Details ▾Hide ▴
Still missing
  • No patient phenotype data provided
PP5 NM_006015.5:c.2378_2396del is absent from ClinVar. PP5 requires a reputable source (ClinVar 3-star expert panel) to have classified the variant as pathogenic. No ClinVar entry exists for this variant. Details ▾Hide ▴
Evidence considered
  • Variant absent from ClinVar
  • no classification available
Sources
clinvar ↗
BA1 NM_006015.5:c.2378_2396del is absent from all population databases (gnomAD v2.1, v4.1, Canada). BA1 requires an allele frequency above 1% in population databases. Details ▾Hide ▴
Evidence considered
  • Allele frequency: 0.0 in all gnomAD datasets
Sources
gnomad_v2 ↗gnomad_v4 ↗
BS1 NM_006015.5:c.2378_2396del is absent from all population databases. BS1 requires an allele frequency above 0.3% (non-VCEP threshold). Details ▾Hide ▴
Evidence considered
  • Allele frequency: 0.0 in all gnomAD datasets
Sources
gnomad_v2 ↗gnomad_v4 ↗
BS2 No observation of this variant in healthy adult individuals has been reported. BS2 requires documented observation in a healthy adult for a disorder with full penetrance expected at an early age. Details ▾Hide ▴
Still missing
  • No healthy control data available
BS3 No variant-specific functional studies demonstrating a benign effect have been reported for NM_006015.5:c.2378_2396del. The four publications reviewed discuss ARID1A as a tumor suppressor with loss-of-function as the pathogenic mechanism, which is consistent with a deleterious effect of this truncating variant, not a benign one. Details ▾Hide ▴
Evidence considered
  • PMID:21900401: rescue of ARID1A expression suppresses tumor growth
  • supporting LoF pathogenicity
  • PMID:24899687: Arid1a deletion collaborates with Pten loss in tumorigenesis
Still missing
  • No experimental data demonstrating benign or neutral effect of this variant
BS4 No segregation data are available for NM_006015.5:c.2378_2396del. BS4 requires lack of segregation in affected family members. Details ▾Hide ▴
Still missing
  • No family segregation data available
BP2 No data on co-occurrence (in trans or in cis) with a pathogenic variant are available for NM_006015.5:c.2378_2396del. Details ▾Hide ▴
Still missing
  • No co-occurrence data available
BP4 SpliceAI predicts no significant splice impact (max delta = 0.16), but multiple independent lines of computational evidence are required for BP4. REVEL and BayesDel are not applicable to deletion variants. A single in silico predictor with a low score is insufficient to meet BP4's requirement for multiple lines of benign evidence. Details ▾Hide ▴
Evidence considered
  • SpliceAI max delta score: 0.16 (no splicing impact)
Still missing
  • Only one applicable in silico tool (SpliceAI)
  • REVEL/BayesDel not applicable to deletions
Sources
spliceai ↗
BP5 No data are available showing this variant in a case with an alternate molecular basis for disease. Details ▾Hide ▴
Still missing
  • No alternate molecular diagnosis data available
BP6 NM_006015.5:c.2378_2396del is absent from ClinVar. BP6 requires a reputable source to have classified the variant as benign. No ClinVar entry exists for this variant. Details ▾Hide ▴
Evidence considered
  • Variant absent from ClinVar
  • no classification available
Sources
clinvar ↗
Not applicable · 9· recorded as not applicable Show reasons ▾Hide reasons ▴
PS1 N/APS1 applies to nucleotide-level changes at the same position. This is a 19-bp deletion, not a single-nucleotide change amenable to PS1 comparison. Details ▾Hide ▴

No further detail was recorded.

PM3 N/ASkipped per user instruction. Details ▾Hide ▴

No further detail was recorded.

PM4 N/APM4 applies to in-frame deletions/insertions in non-repeat regions or stop-loss variants. NM_006015.5:c.2378_2396del is an out-of-frame (frameshift) deletion, not an in-frame change. PM4 does not apply to frameshift variants. Details ▾Hide ▴

No further detail was recorded.

PM5 N/APM5 applies to novel missense changes at the same amino acid residue as a known pathogenic missense variant. NM_006015.5:c.2378_2396del is a frameshift deletion, not a missense change, and has no comparable same-residue missense variants. The automatic PM5 candidate harvest confirmed this is not eligible for classic PM5 search. Details ▾Hide ▴
Sources
pm5_candidates
PP2 N/APP2 applies to missense variants in genes with a low rate of benign missense variation. NM_006015.5:c.2378_2396del is a frameshift deletion, not a missense variant. Details ▾Hide ▴

No further detail was recorded.

BP1 N/ABP1 applies to missense variants in genes for which primarily truncating variants are known to cause disease. NM_006015.5:c.2378_2396del is itself a truncating (frameshift) variant, not a missense variant. Details ▾Hide ▴

No further detail was recorded.

BP3 N/ABP3 applies to in-frame deletions/insertions in repetitive regions without known function. NM_006015.5:c.2378_2396del is an out-of-frame (frameshift) deletion, not an in-frame change. Details ▾Hide ▴

No further detail was recorded.

BP7 N/ABP7 applies to synonymous variants with no predicted splice impact and low nucleotide conservation. NM_006015.5:c.2378_2396del is a frameshift deletion, not a synonymous variant. Details ▾Hide ▴

No further detail was recorded.

PS5 N/APS5 is an obsolete criterion and was replaced by PM5 (stronger weight) and PS2 (de novo) in updated ACMG/AMP frameworks. Details ▾Hide ▴

No further detail was recorded.

Identifiers

Gene
ARID1A
Transcript
NM_006015.5
Coding (HGVS c.)
NM_006015.5:c.2378_2396del
Protein (HGVS p.)
NP_006006.3:p.(Met793ArgfsTer34)
GRCh38
chr1:26762274 TCCATGGGGAGCTATGGTCC>T
GRCh37
chr1:27088765 TCCATGGGGAGCTATGGTCC>T

Gene diagram

Every interpreted variant in ARID1A, mapped onto the exon structure of NM_006015.5. Select a row to find it on the plot.

ARID1ANM_006015.5
Fetching transcript structure from UCSC…
gnomAD v4.1 Allele count data not recorded
gnomAD v2.1 Allele count data not recorded
gnomAD-Canada v1.0 Allele count data not recorded

Statements

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

SpliceAI and Pangolin

SpliceAI acceptor lossat -48 bp
0.010
SpliceAI acceptor gainat -122 bp
0.090
SpliceAI donor lossat +27 bp
0.040
SpliceAI donor gainat +45 bp
0.160
Pangolin splice lossmagnitude shown
-0.060
Pangolin splice gain
0.190

Other predictors

REVEL
Not available
BayesDel
Not available

How the predictions were used

PP3 SpliceAI predicts no significant splice impact for this variant (max delta score = 0.16, well below the 0.2 threshold). REVEL and BayesDel scores are not applicable to deletion variants. No in silico evidence supports a damaging effect. Details ▾Hide ▴
Evidence considered
  • SpliceAI max delta score: 0.16 (below threshold for splicing impact)
  • REVEL and BayesDel not applicable (not a single-nucleotide variant)
Still missing
  • No protein-level in silico predictors applicable to frameshift variants
Sources
spliceai ↗
BP4 SpliceAI predicts no significant splice impact (max delta = 0.16), but multiple independent lines of computational evidence are required for BP4. REVEL and BayesDel are not applicable to deletion variants. A single in silico predictor with a low score is insufficient to meet BP4's requirement for multiple lines of benign evidence. Details ▾Hide ▴
Evidence considered
  • SpliceAI max delta score: 0.16 (no splicing impact)
Still missing
  • Only one applicable in silico tool (SpliceAI)
  • REVEL/BayesDel not applicable to deletions
Sources
spliceai ↗
BP7 N/ABP7 applies to synonymous variants with no predicted splice impact and low nucleotide conservation. NM_006015.5:c.2378_2396del is a frameshift deletion, not a synonymous variant. Details ▾Hide ▴

No further detail was recorded.

Statement

In silico

SpliceAI predicts no significant splice impact for this variant (max delta score = 0.16).

4 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata. None of the listed paper records explicitly indicates that the variant is named.

Recorded publications

  • ARID1A, a factor that promotes formation of SWI/SNF-mediated chromatin remodeling, is a tumor suppressor in gynecologic cancers.
    Reports that restoring wild-type ARID1A expression in ovarian cancer cells harboring ARID1A mutations suppresses cellular proliferation and tumor xenograft growth. Demonstrates ARID1A functions as a tumor suppressor through SWI/SNF-mediated chromatin remodeling.
    Does not name this variant
    PMID 21900401 ↗
  • Somatic mutations in the chromatin remodeling gene ARID1A occur in several tumor types.
    Evaluated 759 malignant neoplasms across multiple tumor types for ARID1A mutations. Identified truncating mutations in 6% of neoplasms studied. Confirms ARID1A as a tumor suppressor with frequent somatic inactivating mutations across cancer types.
    Does not name this variant
    PMID 22009941 ↗
  • Roles of deletion of Arid1a, a tumor suppressor, in mouse ovarian tumorigenesis.
    Demonstrated that Arid1a deletion alone is insufficient for ovarian tumor initiation in a conditional knockout mouse model; requires concurrent Pten deletion. Arid1a/Pten double knockout mice developed ovarian endometrioid and undifferentiated carcinomas at 6-9 months.
    Does not name this variant
    PMID 24899687 ↗
    Quoted passage
    ARID1A is one of the most commonly mutated chromatin remodeling genes in human cancer... The great majority of ARID1A mutations are frameshift or nonsense mutations that occur throughout the coding region, suggesting that ARID1A functions as a tumor suppressor.

    Entire full text searched; variant not found

  • Coexistent ARID1A-PIK3CA mutations promote ovarian clear-cell tumorigenesis through pro-tumorigenic inflammatory cytokine signalling.
    Demonstrated that ARID1A inactivation cooperates with PIK3CA activation to promote ovarian clear-cell tumorigenesis through pro-tumorigenic inflammatory cytokine signaling in a mutant mouse model.
    Does not name this variant
    PMID 25625625 ↗

Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.

gnomAD v4.1 Captured gnomAD v4.1 source record Open source ↗
gnomAD v2.1 Captured gnomAD v2.1 source record Open source ↗
SpliceAI Lookup Recorded maximum delta 0.160 Open source ↗
ClinVar Captured ClinVar source record Open source ↗
COSMIC Captured COSMIC source record Open source ↗
Cancer hotspots Captured Cancer Hotspots source record Open source ↗
OncoKB Captured OncoKB source record Open source ↗

All source links

Statements for reports

The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

gnomAD-Canada

Absent from gnomAD-Canada v1.0.

ClinVar

This variant is absent from ClinVar.

In silico

SpliceAI predicts no significant splice impact for this variant (max delta score = 0.16).

Functional

OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.

Somatic

This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).

Cancer Hotspots

This variant does not lie in a statistically significant hotspot.