About BRCA1
No gene-level summary was recorded for this case.
Previous versions
Variant interpretation report
BRCA1 c.2657_2676del, p.(Ser886Ter)
Classification
Pathogenic
Variant description:
No variant summary was recorded for this case.
Five-step scale from benign to pathogenic. This variant is pathogenic. Select a step to read what it means.
Pathogenic.A pathogenic classification under the recorded framework.
In plain language
Gene-level background from the recorded interpretation.
Words with a dotted underline have a short definition. Hover or tap them.
LYFE Sciences is an AI system, and it can make mistakes.
Criteria may be applied incorrectly, sources may be misread, and a
confident-looking classification can still be wrong.
Double-check every criterion and its underlying evidence
before relying on any call.
01The reasoning
How it was classified
The recorded framework is ClinGen BRCA1 VCEP v1.2.0. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.
Recorded applied criteria
The applied criteria and their strengths are shown as assessed under the stated framework.
Pathogenic evidence criteria: 3
Benign evidence criteria: 0
Pathogenic criteria applied · 3
PVS1Very strong
PVS1 · very strong
NM_007294.4:c.2657_2676del is a 20bp deletion in BRCA1 exon 10(11) (legacy exon 11) that creates a premature termination codon at p.Ser886Ter. BRCA1 loss of function is an established disease mechanism for hereditary breast and ovarian cancer. Per ENIGMA BRCA1 VCEP Specifications Table 4, PTC variants in exon E10(11) are assigned PVS1 (standard weight, Very Strong). The variant is a canonical null variant expected to trigger nonsense-mediated decay, with the PTC located well upstream of the 3'-most 50 nucleotides of the penultimate exon boundary.
PM2Supporting
PM2 · supporting
NM_007294.4:c.2657_2676del is absent from gnomAD v2.1 (non-cancer, exome subset) and gnomAD v4.1 (non-cancer). Per ENIGMA BRCA1 VCEP rules, PM2 is applied at Supporting strength when a variant is absent from controls in an outbred population across both gnomAD versions.
PM5Strong
PM5 · strong
NM_007294.4:c.2657_2676del creates a premature termination codon (p.Ser886Ter) in BRCA1 exon E10(11). Per ENIGMA BRCA1 VCEP Specifications Table 4, PTC variants in exon E10(11) are assigned PM5_Strong (PTC), as other proven pathogenic PTC variants have been reported in this exon. PM5_PTC is applicable because E10(11) is not in the PM5_N/A exclusion list (which includes only E21(22), E6(7), E7(8) for BRCA1).
Benign criteria applied · 0
No benign criterion marked as applied in the recorded assessment.
Recorded classification: Pathogenic
ENIGMA BRCA1 VCEP Specification v1.2.0 Table 3. No conflicting evidence: no benign criteria are met. Pathogenic criteria: PVS1 (Very Strong, 8 pts) + PM5 (Strong, 4 pts) + PM2 (Supporting, 1 pt). Table 3 pathogenic all_of rule satisfied: 1 Very Strong + >=1 Strong -> Pathogenic. ENIGMA point system confirms: 8+4+1 = 13, in Pathogenic range (>=10).
02The sources
Evidence at a glance
Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.
gnomAD v4.1
gnomAD v2.1
Population frequency
Not recorded
gnomAD v4.1 allele counts were not recorded for this variant.
gnomAD v2.1
Absent from gnomAD v2.1.
SpliceAI score
0.000 maximum delta
Recorded SpliceAI maximum delta score: 0.000. Refer to the recorded PP3/BP4 rationale for interpretation.
No listed criterion applied
SpliceAI ↗
ClinVar submissions
Not recorded
A ClinVar laboratory submission summary was not recorded.
Context only
ClinVar ↗
Functional evidence
Statement recorded
OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.
No listed criterion applied
OncoKB ↗
COSMIC
Cancer Hotspots
Somatic evidence
No matching record reported
This variant has not previously been reported in somatic cancers (COSMIC).
Cancer Hotspots
This variant does not lie in a statistically significant hotspot.
Context only
For specialists
Technical detail
ACMG/AMP criteria under ClinGen BRCA1 VCEP v1.2.0, with the data and sources behind each one.
28 criteria with recorded statuses: 3 met · 2 not met · 6 not assessed · 17 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.
Met
Not met
Not assessed
Not applicable
NM_007294.4:c.2657_2676del is a 20bp frameshift deletion in BRCA1 exon 10(11) that creates a premature termination codon at p.Ser886Ter. BRCA1 loss of function is an established mechanism for hereditary breast and ovarian cancer.
Per ENIGMA BRCA1 VCEP Specifications Table 4, PTC variants in exon E10(11) are assigned PVS1 (Very Strong) as null variants in a gene where loss of function is a known disease mechanism, and PM5_Strong (PTC) because other proven pathogenic PTC variants have been reported in this exon.
The variant is absent from gnomAD v2.1 and v4.1 population databases (allele count = 0), meeting PM2 at Supporting strength per ENIGMA population frequency rules.
Applying the ENIGMA Table 3 point system: PVS1 Very Strong = 8 points, PM5 Strong = 4 points, PM2 Supporting = 1 point. Total = 13 points, which falls in the Pathogenic range (>=10).
No criteria match.
Met · 3
PVS1 Very strongNM_007294.4:c.2657_2676del is a 20bp deletion in BRCA1 exon 10(11) (legacy exon 11) that creates a premature termination codon at p.Ser886Ter. BRCA1 loss of function is an established disease mechanism for hereditary breast and ovarian cancer. Per ENIGMA BRCA1 VCEP Specifications Table 4, PTC variants in exon E10(11) are assigned PVS1 (standard weight, Very Strong). The variant is a canonical null variant expected to trigger nonsense-mediated decay, with the PTC located well upstream of the 3'-most 50 nucleotides of the penultimate exon boundary. Details ▾Hide ▴
Evidence considered
- ENIGMA Table 4 assigns PVS1 to PTC variants in BRCA1 exon E10(11)
- Variant creates p.Ser886Ter
- a premature termination codon in exon 10(11) of 23 exons
- BRCA1 loss of function is the established disease mechanism
Sources
vcep_specifications_table4_v1_2_2024_11_18cspec ↗
PM2 SupportingNM_007294.4:c.2657_2676del is absent from gnomAD v2.1 (non-cancer, exome subset) and gnomAD v4.1 (non-cancer). Per ENIGMA BRCA1 VCEP rules, PM2 is applied at Supporting strength when a variant is absent from controls in an outbred population across both gnomAD versions. Details ▾Hide ▴
Evidence considered
- Absent from gnomAD v2.1 (allele count = 0)
- Absent from gnomAD v4.1 (allele count = 0)
- ENIGMA PM2 rule: Supporting strength for absence from population controls
Sources
PM5 StrongNM_007294.4:c.2657_2676del creates a premature termination codon (p.Ser886Ter) in BRCA1 exon E10(11). Per ENIGMA BRCA1 VCEP Specifications Table 4, PTC variants in exon E10(11) are assigned PM5_Strong (PTC), as other proven pathogenic PTC variants have been reported in this exon. PM5_PTC is applicable because E10(11) is not in the PM5_N/A exclusion list (which includes only E21(22), E6(7), E7(8) for BRCA1). Details ▾Hide ▴
Evidence considered
- ENIGMA Table 4 assigns PM5_Strong (PTC) to PTC variants in BRCA1 exon E10(11)
- E10(11) is in the PM5_PTC applicable exon list
- not excluded
- Other proven pathogenic PTC variants have been observed in this exon
Sources
vcep_specifications_table4_v1_2_2024_11_18cspec ↗
Not met · 2 · evaluated, threshold not reached
BA1 BA1 requires filter allele frequency (FAF) above 0.1% (FAF > 0.001) in gnomAD v2.1 (non-cancer, exome only) and/or gnomAD v3.1 (non-cancer), non-founder populations. NM_007294.4:c.2657_2676del is absent from gnomAD v2.1 and v4.1 (allele count = 0). BA1 is not met. Details ▾Hide ▴
Evidence considered
- Variant absent from gnomAD v2.1 (AC=0)
- Variant absent from gnomAD v4.1 (AC=0)
- ENIGMA BA1 threshold: FAF > 0.001
Sources
BS1 BS1 requires filter allele frequency (FAF) above 0.01% (FAF > 0.0001, Strong) or above 0.002% (FAF > 0.00002, Supporting) in gnomAD. NM_007294.4:c.2657_2676del is absent from gnomAD v2.1 and v4.1 (allele count = 0). BS1 is not met. Details ▾Hide ▴
Evidence considered
- Variant absent from gnomAD v2.1 (AC=0)
- Variant absent from gnomAD v4.1 (AC=0)
- ENIGMA BS1 thresholds: Strong FAF > 0.0001
- Supporting FAF > 0.00002
Sources
Not assessed · 6 · no assessment recorded
PS4 PS4 requires case-control data with p-value <=0.05 and OR >=4 (lower CI excludes 2.0) per ENIGMA specifications. No structured case-control study data for NM_007294.4:c.2657_2676del is available in the evidence package. The variant is absent from ClinVar, precluding aggregate case counting from submitted classifications. Exploratory search suggests this variant has been observed in multiple affected individuals in Southern Italian populations, but quantitative case-control statistics could not be verified from the available evidence. Details ▾Hide ▴
PP1 PP1 requires co-segregation data quantified through a likelihood ratio analysis (LR thresholds: Supporting >=2.08, Moderate >=4.3, Strong >=18.7). No co-segregation likelihood ratio data for NM_007294.4:c.2657_2676del is available in the evidence package or ENIGMA supplementary tables. Exploratory evidence suggests this is a founder variant in Southern Italy with reported segregation, but formal LR data could not be verified from available sources. Details ▾Hide ▴
Evidence considered
- No co-segregation LR available in evidence package or VCEP tables
Still missing
- Formal co-segregation LR analysis needed for PP1 assessment
Sources
PP4 PP4 in the ENIGMA BRCA1 framework is assessed using the clinical-history likelihood ratio from Li et al. 2020 (PMID:31853058). NM_007294.4:c.2657_2676del is not listed in the BRCA1 clinical_history_LR spreadsheet (PMID_31853058_BRCA1_clinical_history_LR.xlsx). A related variant, c.2657_2658delCT, is present in the spreadsheet with LR=1.17 (neutral zone, not meeting PP4 threshold), but this is a different variant. Without a direct LR entry for c.2657_2676del, PP4 cannot be assessed from this source. Details ▾Hide ▴
Evidence considered
- Variant not found in Li et al. 2020 BRCA1 clinical history LR table
- c.2657_2658delCT (different variant) has LR=1.17
- in the neutral zone
Still missing
- Clinical-history LR value for this exact variant not available from Li et al. 2020
Sources
BS2 BS2 is applied in the absence of features of recessive disease (Fanconi Anemia phenotype) and requires points-based assessment per ENIGMA Specifications Table 8. No phenotype or homozygous/compound heterozygous observation data for NM_007294.4:c.2657_2676del is available in the evidence package. The variant is absent from gnomAD, making homozygous counts unavailable. BS2 cannot be assessed without observational data in trans with another BRCA1 variant. Details ▾Hide ▴
Evidence considered
- No homozygous or compound heterozygous observations available
- No Fanconi Anemia phenotype data in evidence package
Still missing
- Observational data in trans with another BRCA1 variant needed
- Fanconi Anemia phenotype assessment needed if homozygous/compound het observed
Sources
BS4 BS4 requires quantitative co-segregation analysis showing lack of segregation in affected family members (LR thresholds: Supporting <=0.48, Moderate <=0.23, Strong <=0.05). No co-segregation likelihood ratio data for NM_007294.4:c.2657_2676del is available in the evidence package. The variant is absent from gnomAD, so no observations in presumably unaffected population controls are available to support BS4 either. Details ▾Hide ▴
Evidence considered
- No co-segregation LR data available
- Absent from gnomAD population controls
Still missing
- Co-segregation analysis data needed for BS4 assessment
Sources
BP5 BP5 in the ENIGMA BRCA1 framework is assessed using the clinical-history likelihood ratio from Li et al. 2020 (PMID:31853058), mirroring PP4 in the benign direction. NM_007294.4:c.2657_2676del is not listed in the BRCA1 clinical_history_LR spreadsheet. Without a direct LR entry, BP5 cannot be assessed from this source. Details ▾Hide ▴
Evidence considered
- Variant not found in Li et al. 2020 BRCA1 clinical history LR table
Still missing
- Clinical-history LR value for this exact variant not available from Li et al. 2020
Sources
Not applicable · 17· recorded as not applicable Show reasons ▾Hide reasons ▴
PS1 N/APS1 applies to predicted missense substitutions with a same-residue pathogenic comparator, or to exonic/intronic variants with the same predicted splicing impact as a known pathogenic variant. NM_007294.4:c.2657_2676del is a 20bp frameshift deletion causing a PTC, not a missense substitution, and SpliceAI predicts no splicing impact (max delta = 0.00). PS1 is not applicable to this variant type. Details ▾Hide ▴
Evidence considered
- Variant is a frameshift deletion
- not a missense substitution
- SpliceAI max delta score = 0.00 (no predicted splicing impact)
Sources
PS2 VCEPPS2 (de novo) is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. Details ▾Hide ▴
PS3 N/APS3 and BS3 in the ENIGMA BRCA1 framework are applied using Specification Table 9, which contains calibrated mammalian functional assay results for missense and synonymous variants. NM_007294.4:c.2657_2676del is a 20bp frameshift deletion creating a PTC, not a missense or synonymous variant. This variant is not listed in Table 9. PS3 is not applicable to this variant type under the VCEP rules; the damaging effect of a truncating variant is captured by PVS1 rather than PS3. Details ▾Hide ▴
Evidence considered
- Variant not listed in ENIGMA Table 9 (missense/synonymous calibrated functional assays only)
- Truncating variant effect captured by PVS1 per ENIGMA framework
Sources
cspec ↗vcep_specifications_table9_v1_2_2024_11_18
PM1 VCEPPM1 is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. Details ▾Hide ▴
PM4 VCEPPM4 is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. Details ▾Hide ▴
PM6 VCEPPM6 (de novo) is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. Details ▾Hide ▴
PP2 VCEPPP2 is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. Details ▾Hide ▴
PP3 N/APP3 in the ENIGMA BRCA1 framework applies to missense or in-frame variants inside clinically important functional domains with BayesDel >=0.28, or variants with SpliceAI >=0.2 predicting a splicing effect. NM_007294.4:c.2657_2676del is a frameshift deletion (20bp, not in-frame) creating a PTC. SpliceAI predicts no splicing impact (max delta = 0.00). BayesDel and REVEL scores are not applicable for deletions. The variant does not meet the variant-type prerequisites for PP3 application under ENIGMA rules. Details ▾Hide ▴
Evidence considered
- Variant is a frameshift deletion
- not missense or in-frame
- SpliceAI max delta = 0.00 (no predicted splicing impact)
- BayesDel/REVEL not applicable for deletions
Sources
PP5 VCEPPP5 is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. Details ▾Hide ▴
BS3 N/ABS3 in the ENIGMA BRCA1 framework is applied using Specification Table 9, which contains calibrated functional assay results for missense and synonymous variants showing no damaging effect on protein function. NM_007294.4:c.2657_2676del is a 20bp frameshift deletion creating a PTC, not a missense or synonymous variant. It is not listed in Table 9. BS3 is not applicable to this variant type; truncating variant effects are assessed through PVS1 and PM5. Details ▾Hide ▴
Evidence considered
- Variant not listed in ENIGMA Table 9 (missense/synonymous calibrated functional assays only)
- Truncating variant effect captured by PVS1/PM5 per ENIGMA framework
Sources
cspec ↗vcep_specifications_table9_v1_2_2024_11_18
BP1 N/ABP1 in the ENIGMA BRCA1 framework applies to silent substitutions, missense variants, or in-frame insertions/deletions/delins variants outside clinically important functional domains with no splicing predicted (SpliceAI <=0.1). NM_007294.4:c.2657_2676del is a 20bp frameshift deletion (not in-frame), creating a PTC. The variant type does not meet the BP1 prerequisites under ENIGMA rules. Details ▾Hide ▴
Evidence considered
- Variant is a frameshift deletion
- not an in-frame deletion
- missense
- or silent substitution
Sources
BP2 VCEPBP2 is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. Details ▾Hide ▴
BP3 VCEPBP3 is marked Not Applicable by the ENIGMA BRCA1 VCEP specification (captured by bioinformatic tool prediction and domain analysis). Details ▾Hide ▴
BP4 N/ABP4 in the ENIGMA BRCA1 framework applies to missense or in-frame insertion/deletion/delins variants inside clinically important functional domains with no predicted impact (BayesDel no-AF <=0.15 AND SpliceAI <=0.1), or silent/intronic variants with no splicing predicted. NM_007294.4:c.2657_2676del is a 20bp frameshift deletion (not in-frame) creating a PTC. The variant type does not meet the BP4 prerequisites under ENIGMA rules. Details ▾Hide ▴
Evidence considered
- Variant is a frameshift deletion
- not an in-frame deletion
- missense
- silent
- or intronic variant
- SpliceAI max delta = 0.00
Sources
BP6 VCEPBP6 is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. Details ▾Hide ▴
BP7 N/ABP7 in the ENIGMA BRCA1 framework applies to intronic and silent variants, and missense/in-frame variants located outside clinically important functional domains, based on mRNA splicing assay evidence. NM_007294.4:c.2657_2676del is a 20bp frameshift deletion creating a PTC. This variant type is not among those eligible for BP7 under ENIGMA rules. The variant produces a truncation, which is assessed through PVS1. Details ▾Hide ▴
Evidence considered
- Variant is a frameshift deletion/PTC
- not eligible for BP7 under ENIGMA rules
- Truncating effect captured by PVS1
Sources
PS5 N/APS5 (PP5) is marked Not Applicable by the ENIGMA BRCA1 VCEP specification. Details ▾Hide ▴
Identifiers
- Gene
- BRCA1
- Transcript
- NM_007294.4
- Coding (HGVS c.)
- NM_007294.4:c.2657_2676del
- Protein (HGVS p.)
- NP_009225.1:p.(Ser886Ter)
- GRCh38
- chr17:43092854 TTAAGGACCCAGAGTGGGCAG>T
- GRCh37
- chr17:41244871 TTAAGGACCCAGAGTGGGCAG>T
Gene diagram
Every interpreted variant in BRCA1, mapped onto the exon structure of NM_007294.4. Select a row to find it on the plot.
BRCA1NM_007294.4
Fetching transcript structure from UCSC…
Exons
—
Transcript span
—
Strand
—
Variants mapped
—
Source
UCSC ncbiRefSeqCurated
All variants in BRCA1
—
Select a row to find it on the plot; use the link to open its page.
| Protein | Location | Classification | Link |
|---|
gnomAD v4.1
Allele count data not recorded
gnomAD v2.1
Allele count data not recorded
gnomAD-Canada v1.0
0 / 0 alleles
AF 0 · 0 homozygotes · FAF 0
By genetic ancestry
gnomAD-Canada
AF 0 · 0 / 0 alleles · 0 hom
Statements
gnomAD v4.1
Absent from gnomAD v4.1.
gnomAD v2.1
Absent from gnomAD v2.1.
SpliceAI and Pangolin
Other predictors
- REVEL
- Not available
- BayesDel
- Not available
How the predictions were used
PP3 N/APP3 in the ENIGMA BRCA1 framework applies to missense or in-frame variants inside clinically important functional domains with BayesDel >=0.28, or variants with SpliceAI >=0.2 predicting a splicing effect. NM_007294.4:c.2657_2676del is a frameshift deletion (20bp, not in-frame) creating a PTC. SpliceAI predicts no splicing impact (max delta = 0.00). BayesDel and REVEL scores are not applicable for deletions. The variant does not meet the variant-type prerequisites for PP3 application under ENIGMA rules. Details ▾Hide ▴
Evidence considered
- Variant is a frameshift deletion
- not missense or in-frame
- SpliceAI max delta = 0.00 (no predicted splicing impact)
- BayesDel/REVEL not applicable for deletions
Sources
BP4 N/ABP4 in the ENIGMA BRCA1 framework applies to missense or in-frame insertion/deletion/delins variants inside clinically important functional domains with no predicted impact (BayesDel no-AF <=0.15 AND SpliceAI <=0.1), or silent/intronic variants with no splicing predicted. NM_007294.4:c.2657_2676del is a 20bp frameshift deletion (not in-frame) creating a PTC. The variant type does not meet the BP4 prerequisites under ENIGMA rules. Details ▾Hide ▴
Evidence considered
- Variant is a frameshift deletion
- not an in-frame deletion
- missense
- silent
- or intronic variant
- SpliceAI max delta = 0.00
Sources
BP7 N/ABP7 in the ENIGMA BRCA1 framework applies to intronic and silent variants, and missense/in-frame variants located outside clinically important functional domains, based on mRNA splicing assay evidence. NM_007294.4:c.2657_2676del is a 20bp frameshift deletion creating a PTC. This variant type is not among those eligible for BP7 under ENIGMA rules. The variant produces a truncation, which is assessed through PVS1. Details ▾Hide ▴
Evidence considered
- Variant is a frameshift deletion/PTC
- not eligible for BP7 under ENIGMA rules
- Truncating effect captured by PVS1
Sources
Statement
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.00).
4 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata. None of the listed paper records explicitly indicates that the variant is named.
Recorded publications
-
PMID 11358863 ↗Tumorigenesis in mice carrying a truncating Brca1 mutation.No paper-specific finding is recorded.
-
PMID 12483515 ↗The cancer connection: BRCA1 and BRCA2 tumor suppression in mice and humans.No paper-specific finding is recorded.
-
PMID 12947386 ↗Roles of BRCA1 and BRCA2 in homologous recombination, DNA replication fidelity and the cellular response to ionizing radiation.No paper-specific finding is recorded.
-
PMID 20608970 ↗BRCA1 16 years later: risk-associated BRCA1 mutations and their functional implications.No paper-specific finding is recorded.
Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.
gnomAD v4.1
Captured gnomAD v4.1 source record
Open source ↗
gnomAD v2.1
Captured gnomAD v2.1 source record
Open source ↗
SpliceAI Lookup
Recorded maximum delta 0.000
Open source ↗
ClinVar
Captured ClinVar source record
Open source ↗
COSMIC
Captured COSMIC source record
Open source ↗
Cancer hotspots
Captured Cancer Hotspots source record
Open source ↗
OncoKB
Captured OncoKB source record
Open source ↗
ClinGen CSpec
Captured ClinGen CSpec source record
Open source ↗
All source links
- ClinGen CSpec ↗cspec.genome.network/cspec/ui/svi/doc/1530970787
- ClinVar ↗www.ncbi.nlm.nih.gov/clinvar/?term=NM_007294.4%3Ac.2657_2676del
- gnomAD v2.1 ↗gnomad.broadinstitute.org/variant/17-41244871-TTAAGGACCCAGAGTGG…
- gnomAD v4.1 ↗gnomad.broadinstitute.org/variant/chr17-43092854-TTAAGGACCCAGAG…
- SpliceAI Lookup ↗spliceailookup.broadinstitute.org/#variant=NM_007294.4%3Ac.2657…
- OncoKB ↗www.oncokb.org/gene/BRCA1/S886*
- COSMIC ↗cancer.sanger.ac.uk/cosmic/search?q=BRCA1+c.2657_2676del
- Cancer hotspots ↗www.cancerhotspots.org/
Statements for reports
The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.
gnomAD v4.1
Absent from gnomAD v4.1.
gnomAD v2.1
Absent from gnomAD v2.1.
ClinVar
This variant is absent from ClinVar.
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.00).
Functional
OncoKB identified variant-specific curated literature and context relevant to functional review; biological-effect context: Likely Loss-of-function; curated oncogenicity label: Likely Oncogenic.
Somatic
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Cancer Hotspots
This variant does not lie in a statistically significant hotspot.