About BCORL1
No gene-level summary was recorded for this case.
Previous versions
Variant interpretation report
BCORL1 c.643_798dup, p.(His215_Pro266dup)
Classification
Uncertain significance
Variant description:
No variant summary was recorded for this case.
Five-step scale from benign to pathogenic. This variant is uncertain. Select a step to read what it means.
Uncertain.The recorded classification is uncertain significance.
In plain language
Gene-level background from the recorded interpretation.
Words with a dotted underline have a short definition. Hover or tap them.
LYFE Sciences is an AI system, and it can make mistakes.
Criteria may be applied incorrectly, sources may be misread, and a
confident-looking classification can still be wrong.
Double-check every criterion and its underlying evidence
before relying on any call.
01The reasoning
How it was classified
The recorded framework is Not recorded. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.
Recorded applied criteria
The applied criteria and their strengths are shown as assessed under the stated framework.
Pathogenic evidence criteria: 1
Benign evidence criteria: 0
Pathogenic criteria applied · 1
PM2Supporting
PM2 · supporting
This variant is absent from gnomAD v2.1 and absent from gnomAD v4.1. Its observed population frequency is therefore 0, which is below the non-VCEP PM2 threshold of 0.1%, supporting rarity.
Benign criteria applied · 0
No benign criterion marked as applied in the recorded assessment.
Recorded classification: Uncertain significance
gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PM2 supporting; combination = 1 supporting, which maps to VUS.
02The sources
Evidence at a glance
Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.
gnomAD v4.1
gnomAD v2.1
Population frequency
Not recorded
gnomAD v4.1 allele counts were not recorded for this variant.
gnomAD v2.1
Absent from gnomAD v2.1.
No screenshot for this evidence
Computational predictions
Not recorded
No SpliceAI or REVEL score is recorded in the fields used for this tile.
No listed criterion applied
ClinVar submissions
Not recorded
A ClinVar laboratory submission summary was not recorded.
Context only
ClinVar ↗
Functional evidence
Statement recorded
OncoKB did not identify variant-specific reviewed functional evidence for this variant; gene-level curated context is available for reviewer follow-up. BCORL1, a transcriptional repressor, is recurrently mutated in hematopoietic malignancies, astrocytomas, and intracranial germ cell tumors.
No listed criterion applied
OncoKB ↗
COSMIC
Cancer Hotspots
Somatic evidence
Not assessed
No COSMIC evidence statement is recorded in this case.
Cancer Hotspots
This variant does not lie in a statistically significant hotspot.
Context only
For specialists
Technical detail
ACMG/AMP criteria under Not recorded, with the data and sources behind each one.
28 criteria with recorded statuses: 1 met · 7 not met · 16 not assessed · 4 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.
Met
Not met
Not assessed
Not applicable
The BCORL1 c.643_798dup (p.His215_Pro266dup) variant has not been observed in somatic cancer records in COSMIC and has not been reported in ClinVar.
This variant is absent from gnomAD v2.1 and absent from gnomAD v4.1, with an observed population frequency of 0, which is below the 0.1% rarity threshold used for PM2.
In silico splice prediction does not support an abnormal splicing effect, with a SpliceAI maximum delta score of 0.00.
No criteria match.
Met · 1
PM2 SupportingThis variant is absent from gnomAD v2.1 and absent from gnomAD v4.1. Its observed population frequency is therefore 0, which is below the non-VCEP PM2 threshold of 0.1%, supporting rarity. Details ▾Hide ▴
Not met · 7 · evaluated, threshold not reached
PVS1 BCORL1 loss of function appears to be an established germline disease mechanism, but this variant is an in-frame duplication rather than a nonsense, frameshift, or canonical splice-site variant. Under the generic PVS1 framework, available evidence does not support applying PVS1 to this variant. Details ▾Hide ▴
Evidence considered
- Gene-level loss-of-function mechanism supported for BCORL1
- Variant-level scaffold classified the event outside default PVS1 null-variant buckets
Still missing
- No direct evidence was identified that this in-frame duplication causes transcript loss or a null effect.
- No variant-specific RNA or protein study was identified to show a loss-of-function consequence.
Sources
PS4 This variant has not been reported in ClinVar or COSMIC, and no case series or enrichment data in affected individuals were identified. Available evidence does not support increased prevalence in affected individuals over controls. Details ▾Hide ▴
Evidence considered
- Absent from ClinVar
- Not reported in COSMIC
- Absent from gnomAD v2.1 and v4.1
Still missing
- No affected-case counts were identified.
- No case-control or enrichment study was identified.
Sources
PM1 This variant does not lie in a statistically significant hotspot, and no critical functional domain with established pathogenic clustering at this interval was identified. Available evidence does not support PM1. Details ▾Hide ▴
Evidence considered
- No statistically significant hotspot identified
- No variant-specific reviewed evidence identified in OncoKB
Still missing
- No domain-specific clustering data for residues His215 to Pro266 were identified.
- No disease-specific hotspot evidence was identified.
Sources
PP3 SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.00. REVEL and BayesDel were not available because this is not a single-nucleotide variant, and available computational evidence does not support a damaging prediction. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta score 0.00
- REVEL and BayesDel not available for this variant type
Still missing
- No applicable protein-level ensemble predictor score was available for this in-frame duplication.
Sources
BA1 This variant is absent from gnomAD v2.1 and v4.1. Its observed population frequency is 0, which is below the BA1 threshold of 1%, so BA1 is not met. Details ▾Hide ▴
BS1 This variant is absent from gnomAD v2.1 and v4.1. Its observed population frequency is 0, which is below the BS1 threshold of 0.3%, so BS1 is not met. Details ▾Hide ▴
BP4 SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.00, but this alone does not establish a benign protein effect for an in-frame duplication. REVEL and BayesDel were not available because this is not a single-nucleotide variant, so available computational evidence is insufficient to support BP4. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta score 0.00
- REVEL and BayesDel not available for this variant type
Still missing
- No applicable benign protein-level computational predictor result was available for this in-frame duplication.
Sources
Not assessed · 16 · no assessment recorded
PS1 PS1 is intended for the same amino acid change as a previously established pathogenic variant. No such comparison variant was identified. Details ▾Hide ▴
Evidence considered
- No ClinVar record identified for this variant
Still missing
- No established pathogenic variant producing the same amino acid change was identified.
Sources
PS2 No de novo data were identified for this variant. Available evidence does not support confirmed maternity and paternity with a de novo occurrence. Details ▾Hide ▴
Evidence considered
- No de novo evidence identified
Still missing
- No parental testing data were identified.
- No patient-level report describing a confirmed de novo occurrence was identified.
PS3 No well-established functional study of this specific variant was identified. Available evidence does not show a damaging effect in a validated assay. Details ▾Hide ▴
Evidence considered
- No variant-specific reviewed functional evidence identified
Still missing
- No variant-specific functional assay was identified.
Sources
PM3 No phase data or additional pathogenic variant data were identified. Available evidence does not support evaluation under PM3. Details ▾Hide ▴
Evidence considered
- No phase evidence identified
Still missing
- No in trans observation with another pathogenic variant was identified.
PM4 This variant is an in-frame protein duplication, but available evidence does not establish that this protein length change occurs in a clearly non-repetitive, functionally constrained region or has a demonstrated pathogenic effect. Additional variant-specific or domain-specific evidence would be needed to apply PM4. Details ▾Hide ▴
Evidence considered
- No variant-specific reviewed functional evidence identified
Still missing
- No variant-specific functional evidence was identified.
- No clear domain-level evidence was identified showing that this in-frame duplication disrupts a critical constrained region.
Sources
PM6 No assumed de novo occurrence was identified for this variant. Available evidence does not support PM6. Details ▾Hide ▴
Evidence considered
- No de novo evidence identified
Still missing
- No patient-level report with an assumed but unconfirmed de novo occurrence was identified.
PP1 No segregation data were identified for this variant. Available evidence does not support co-segregation with disease in multiple affected family members. Details ▾Hide ▴
Evidence considered
- No segregation evidence identified
Still missing
- No pedigree or family segregation data were identified.
PP4 No phenotype information was provided to assess whether the clinical presentation is highly specific for a BCORL1-related disorder. Available evidence does not support PP4. Details ▾Hide ▴
Evidence considered
- No phenotype-specific evidence identified
Still missing
- No phenotype
- inheritance
- or clinical correlation data were identified.
PP5 No reputable source classification for this specific variant was identified. Available evidence does not support PP5. Details ▾Hide ▴
Evidence considered
- No ClinVar record identified
Still missing
- No external pathogenic classification for this exact variant was identified.
Sources
BS2 No evidence was identified showing this variant in healthy adults for a disorder with expected full penetrance at an early age. Available evidence does not support BS2. Details ▾Hide ▴
Evidence considered
- No healthy adult observation identified
Still missing
- No unaffected carrier data were identified.
BS3 No well-established functional study showing normal function for this specific variant was identified. Available evidence does not support BS3. Details ▾Hide ▴
Evidence considered
- No variant-specific reviewed functional evidence identified
Still missing
- No benign functional assay result was identified for this variant.
Sources
BS4 No non-segregation data were identified for this variant. Available evidence does not support BS4. Details ▾Hide ▴
Evidence considered
- No non-segregation evidence identified
Still missing
- No family data demonstrating lack of segregation were identified.
BP2 No phase information or additional variant data were identified to assess BP2. Available evidence does not support this criterion. Details ▾Hide ▴
Evidence considered
- No phase evidence identified
Still missing
- No cis/trans observations with another variant were identified.
BP3 This variant is an in-frame duplication, but available evidence does not adequately establish that it lies within a benign repetitive region without known function. Additional protein-region evidence would be needed to apply BP3 confidently. Details ▾Hide ▴
Evidence considered
- In-frame duplication without sufficient benign regional annotation
Still missing
- No validated repeat-region annotation or benign regional evidence was identified for this interval.
BP5 No alternate molecular diagnosis or alternate established cause for the phenotype was identified. Available evidence does not support BP5. Details ▾Hide ▴
Evidence considered
- No alternate molecular explanation identified
Still missing
- No phenotype-specific alternate diagnosis data were identified.
BP6 No reputable source benign classification for this specific variant was identified. Available evidence does not support BP6. Details ▾Hide ▴
Evidence considered
- No ClinVar record identified
Still missing
- No external benign classification for this exact variant was identified.
Sources
Not applicable · 4· recorded as not applicable Show reasons ▾Hide reasons ▴
PM5 N/APM5 is intended for a novel missense change at an amino acid residue where a different pathogenic missense change is established. This variant is an in-frame duplication, so PM5 is not applicable. Details ▾Hide ▴
Evidence considered
- Variant is an in-frame duplication rather than a missense substitution
PP2 N/APP2 is a missense criterion. This variant is an in-frame duplication, so PP2 is not applicable. Details ▾Hide ▴
Evidence considered
- Variant is not missense
BP1 N/ABP1 is intended for missense variants in genes where truncating variants are the main known mechanism. This variant is an in-frame duplication, so BP1 is not applicable. Details ▾Hide ▴
Evidence considered
- Variant is not missense
BP7 N/ABP7 is intended for synonymous or certain noncoding variants with no predicted splice impact. This variant is an in-frame coding duplication, so BP7 is not applicable. Details ▾Hide ▴
Evidence considered
- Variant is a coding in-frame duplication
- SpliceAI shows no significant splice impact
Sources
Identifiers
- Gene
- BCORL1
- Transcript
- NM_021946.4
- Coding (HGVS c.)
- NM_021946.4:c.643_798dup
- Protein (HGVS p.)
- NP_068765.3:p.(His215_Pro266dup)
- GRCh38
- chrX:130013408 T>TGTGCCCCACTCTGTTCCAGATGCATTCCAGGTTCCCCTCTCCGTCCCTGCCCCAGTCCCCCATTCAGGGCTTGTTCCAGTCCAAGTTGCCACTTCGGTTCCAGCTCCTTCCCCTCCCTTAGCACCTGTCCCGGCTCTGGCTCCAGCGCCACCGTCA
- GRCh37
- chrX:129147384 T>TGTGCCCCACTCTGTTCCAGATGCATTCCAGGTTCCCCTCTCCGTCCCTGCCCCAGTCCCCCATTCAGGGCTTGTTCCAGTCCAAGTTGCCACTTCGGTTCCAGCTCCTTCCCCTCCCTTAGCACCTGTCCCGGCTCTGGCTCCAGCGCCACCGTCA
Gene diagram
Every interpreted variant in BCORL1, mapped onto the exon structure of NM_021946.4. Select a row to find it on the plot.
BCORL1NM_021946.4
Fetching transcript structure from UCSC…
Exons
—
Transcript span
—
Strand
—
Variants mapped
—
Source
UCSC ncbiRefSeqCurated
All variants in BCORL1
—
Select a row to find it on the plot; use the link to open its page.
| Protein | Location | Classification | Link |
|---|
gnomAD v4.1
Allele count data not recorded
gnomAD v2.1
Allele count data not recorded
Statements
gnomAD v4.1
Absent from gnomAD v4.1.
gnomAD v2.1
Absent from gnomAD v2.1.
Other predictors
- REVEL
- Not available
- BayesDel
- Not available
How the predictions were used
PP3 SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.00. REVEL and BayesDel were not available because this is not a single-nucleotide variant, and available computational evidence does not support a damaging prediction. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta score 0.00
- REVEL and BayesDel not available for this variant type
Still missing
- No applicable protein-level ensemble predictor score was available for this in-frame duplication.
Sources
BP4 SpliceAI predicts no significant splice impact for this variant, with a maximum delta score of 0.00, but this alone does not establish a benign protein effect for an in-frame duplication. REVEL and BayesDel were not available because this is not a single-nucleotide variant, so available computational evidence is insufficient to support BP4. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta score 0.00
- REVEL and BayesDel not available for this variant type
Still missing
- No applicable benign protein-level computational predictor result was available for this in-frame duplication.
Sources
BP7 N/ABP7 is intended for synonymous or certain noncoding variants with no predicted splice impact. This variant is an in-frame coding duplication, so BP7 is not applicable. Details ▾Hide ▴
Evidence considered
- Variant is a coding in-frame duplication
- SpliceAI shows no significant splice impact
Sources
Statement
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.00).
0 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata.
Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.
gnomAD v4.1
Captured gnomAD v4.1 source record
Open source ↗
gnomAD v2.1
Captured gnomAD v2.1 source record
Open source ↗
SpliceAI Lookup
Captured SpliceAI source record
Open source ↗
ClinVar
Captured ClinVar source record
Open source ↗
COSMIC
Captured COSMIC source record
Open source ↗
Cancer hotspots
Captured Cancer Hotspots source record
Open source ↗
OncoKB
Captured OncoKB source record
Open source ↗
All source links
- ClinVar ↗www.ncbi.nlm.nih.gov/clinvar/?term=NM_021946.4%3Ac.643_798dup
- gnomAD v2.1 ↗gnomad.broadinstitute.org/variant/X-129147384-T-TGTGCCCCACTCTGT…
- gnomAD v4.1 ↗gnomad.broadinstitute.org/variant/chrX-130013408-T-TGTGCCCCACTC…
- SpliceAI Lookup ↗spliceailookup.broadinstitute.org/#variant=NM_021946.4%3Ac.643_…
- OncoKB ↗www.oncokb.org/gene/BCORL1/H215_P266dup
- COSMIC ↗cancer.sanger.ac.uk/cosmic/search?q=BCORL1+c.643_798dup
- Cancer hotspots ↗www.cancerhotspots.org/
Statements for reports
The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.
gnomAD v4.1
Absent from gnomAD v4.1.
gnomAD v2.1
Absent from gnomAD v2.1.
ClinVar
This variant is absent from ClinVar.
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.00).
Functional
OncoKB did not identify variant-specific reviewed functional evidence for this variant; gene-level curated context is available for reviewer follow-up. BCORL1, a transcriptional repressor, is recurrently mutated in hematopoietic malignancies, astrocytomas, and intracranial germ cell tumors.
Somatic
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Cancer Hotspots
This variant does not lie in a statistically significant hotspot.