0%
DNMT3Ac.856-59_1014+13dupUncertain significance
Print report
Variant interpretation report

DNMT3A c.856-59_1014+13dup, p.?

NM_022552.4:c.856-59_1014+13dup NP_072046.2:p.? View identifiers
Classification
Uncertain significance

Variant description:

No variant summary was recorded for this case.

Five-step scale from benign to pathogenic. This variant is uncertain. Select a step to read what it means.

Uncertain.The recorded classification is uncertain significance.

In plain language

Gene-level background from the recorded interpretation.

About DNMT3A

No gene-level summary was recorded for this case.

LYFE Sciences is an AI system, and it can make mistakes. Criteria may be applied incorrectly, sources may be misread, and a confident-looking classification can still be wrong. Double-check every criterion and its underlying evidence before relying on any call.
01The reasoning

How it was classified

The recorded framework is Not recorded. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.

Recorded applied criteria

The applied criteria and their strengths are shown as assessed under the stated framework.

Pathogenic evidence criteria: 2 Benign evidence criteria: 0
Pathogenic criteria applied · 2
PM2Supporting
PM2 · supporting

This variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed population frequency is below the non-VCEP PM2 threshold of 0.1%, supporting rarity.

PP3Supporting
PP3 · supporting

SpliceAI predicts a strong splice effect for this variant, with a maximum delta score of 0.91, which is above commonly used concern thresholds and supports an abnormal splicing effect. REVEL and BayesDel were not available because this is not an SNV.

Benign criteria applied · 0

No benign criterion marked as applied in the recorded assessment.

Recorded classification: Uncertain significance

gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PM2 supporting, PP3 supporting; combination = 2 supporting, which maps to VUS.

02The sources

Evidence at a glance

Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.

No screenshot for this evidence
Computational predictions
Not recorded

No SpliceAI or REVEL score is recorded in the fields used for this tile.

Applied · PP3 →
ClinVar submissions
Not recorded

A ClinVar laboratory submission summary was not recorded.

Context only ClinVar ↗
No screenshot for this evidence
Functional evidence
Not recorded

No standalone functional evidence summary is recorded in evidence_summary.functional.

No listed criterion applied OncoKB ↗
Somatic evidence
Not assessed

No COSMIC evidence statement is recorded in this case.

Context only COSMIC ↗
For specialists

Technical detail

ACMG/AMP criteria under Not recorded, with the data and sources behind each one.

28 criteria with recorded statuses: 2 met · 5 not met · 16 not assessed · 5 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.

Pathogenic
PVS1PS1PS2PS3PS4PM1PM2PM3PM4PM5PM6PP1PP2PP3PP4PP5
Benign
BA1BS1BS2BS3BS4BP1BP2BP3BP4BP5BP6BP7
Met Not met Not assessed Not applicable

The DNMT3A c.856-59_1014+13dup (p.?) variant has not been observed in somatic cancers in COSMIC and has not been reported in ClinVar.

This variant is absent from gnomAD v2.1 and gnomAD v4.1, so its population frequency is below the non-VCEP PM2 threshold of 0.1%.

SpliceAI predicts a strong splice effect with a maximum delta score of 0.91, supporting possible abnormal splicing, although the exact transcript consequence of this intragenic duplication remains uncertain.

Met · 2

PM2 SupportingThis variant is absent from gnomAD v2.1 and gnomAD v4.1, so the observed population frequency is below the non-VCEP PM2 threshold of 0.1%, supporting rarity. Details ▾Hide ▴
Rule
Absent or extremely rare in population databases; below 0.1% threshold.
Evidence considered
  • Absent from gnomAD v2.1.
  • Absent from gnomAD v4.1.
Sources
gnomad_v2 ↗gnomad_v4 ↗
PP3 SupportingSpliceAI predicts a strong splice effect for this variant, with a maximum delta score of 0.91, which is above commonly used concern thresholds and supports an abnormal splicing effect. REVEL and BayesDel were not available because this is not an SNV. Details ▾Hide ▴
Rule
Computational evidence supports a deleterious splicing effect.
Evidence considered
  • SpliceAI max delta score 0.91.
  • Predicted acceptor gain and donor gain signals are high.
Still missing
  • RNA confirmation of the predicted splice effect was not identified.
Sources
spliceai ↗

Not met · 5 · evaluated, threshold not reached

PVS1 Loss of function is an established DNMT3A disease mechanism, but this duplication does not fall into the default generic PVS1 null-variant categories of nonsense, frameshift, or canonical +/-1,2 splice variants. The exact transcript consequence remains uncertain for this intragenic duplication, so PVS1 is not applied. Details ▾Hide ▴
Evidence considered
  • DNMT3A loss of function is supported as a germline disease mechanism.
  • Variant-level PVS1 scaffold does not place this duplication in a default null-variant bucket.
Still missing
  • RNA studies showing the actual splicing consequence were not identified.
  • Breakpoint orientation and tandem configuration were not established.
Sources
pvs1_gene_contextpvs1_variant_assessmentpvs1_generic_framework ↗
BA1 This variant is absent from gnomAD v2.1 and gnomAD v4.1 and therefore does not meet the stand-alone benign frequency threshold of 1%. Details ▾Hide ▴
Rule
Benign stand-alone frequency threshold >1% not reached.
Evidence considered
  • Absent from gnomAD v2.1.
  • Absent from gnomAD v4.1.
Sources
gnomad_v2 ↗gnomad_v4 ↗
BS1 This variant is absent from gnomAD v2.1 and gnomAD v4.1 and therefore does not meet the benign strong frequency threshold of 0.3%. Details ▾Hide ▴
Rule
Benign strong frequency threshold >0.3% not reached.
Evidence considered
  • Absent from gnomAD v2.1.
  • Absent from gnomAD v4.1.
Sources
gnomad_v2 ↗gnomad_v4 ↗
BP4 Available computational evidence does not support a benign interpretation. SpliceAI predicts a substantial splice effect with a maximum delta score of 0.91, which argues against BP4. Details ▾Hide ▴
Rule
Benign computational evidence is not present.
Evidence considered
  • SpliceAI max delta score 0.91 indicates predicted splice disruption.
Sources
spliceai ↗
BP7 BP7 is not supported because computational evidence predicts splice disruption rather than no impact on splicing. SpliceAI shows a maximum delta score of 0.91. Details ▾Hide ▴
Rule
No-splice-impact computational criterion is not satisfied.
Evidence considered
  • SpliceAI max delta score 0.91.
Sources
spliceai ↗

Not assessed · 16 · no assessment recorded

PS2 No confirmed de novo occurrence with verified maternity and paternity was identified for this variant, so PS2 cannot be assessed from the available evidence. Details ▾Hide ▴
Evidence considered
  • No case-level inheritance evidence was identified for this variant.
Still missing
  • Confirmed de novo testing data were not available.
PS3 No well-established functional study was identified for this variant. In particular, no RNA study or other assay was found to show whether this duplication causes abnormal splicing or another damaging effect. Details ▾Hide ▴
Evidence considered
  • No variant-specific functional evidence was found.
Still missing
  • Variant-specific RNA studies were not identified.
  • Variant-specific functional assay data were not identified.
PS4 No evidence was identified showing that this exact variant is enriched in affected individuals compared with controls, so PS4 is not met. Details ▾Hide ▴
Evidence considered
  • This variant was not found in ClinVar.
  • This variant was not found in COSMIC.
Still missing
  • No affected proband series for this exact variant was identified.
  • No case-control enrichment data were identified.
Sources
clinvar ↗
PM1 No evidence was identified that this duplication affects a well-established critical functional domain or mutational hot spot without benign variation. Details ▾Hide ▴
Evidence considered
  • No domain or hot-spot evidence was available for this variant.
Still missing
  • Domain-specific or hot-spot evidence for this exact duplicated region was not identified.
PM4 This intragenic duplication spans intronic sequence on both sides of a coding segment, and the actual transcript and protein consequences remain uncertain. Because it is not established that the mature transcript contains a simple in-frame protein length change, PM4 is not applied. Details ▾Hide ▴
Evidence considered
  • Protein consequence is p.?.
  • Predicted splice impact suggests the outcome may not be a simple in-frame duplication.
Still missing
  • Transcript-level confirmation of the duplicated sequence in RNA was not identified.
Sources
pvs1_variant_assessmentspliceai ↗
PM6 No report was identified showing this variant to be apparently de novo without confirmed parentage, so PM6 cannot be assessed. Details ▾Hide ▴
Evidence considered
  • No case-level inheritance evidence was identified for this variant.
Still missing
  • Apparent de novo case data were not available.
PP1 No segregation data were identified for this variant, so PP1 cannot be assessed. Details ▾Hide ▴
Evidence considered
  • No pedigree or segregation evidence was identified.
Still missing
  • Family segregation data were not available.
PP4 No phenotype or family history information was provided to determine whether the clinical presentation is highly specific for a DNMT3A-related disorder, so PP4 cannot be assessed. Details ▾Hide ▴
Evidence considered
  • No case-specific phenotype data were available.
Still missing
  • Phenotype information was not available.
PP5 No reputable source classification for this exact variant was identified. This variant is absent from ClinVar, so PP5 is not met. Details ▾Hide ▴
Evidence considered
  • This variant is absent from ClinVar.
Sources
clinvar ↗
BS2 No evidence was identified showing this variant in healthy adult individuals in a context sufficient to support BS2. Details ▾Hide ▴
Evidence considered
  • No healthy carrier evidence was available.
Still missing
  • Observation in unaffected individuals was not identified.
BS3 No well-established functional study showing no damaging effect was identified for this variant, so BS3 cannot be applied. Details ▾Hide ▴
Evidence considered
  • No benign functional evidence was found.
Still missing
  • Negative functional or RNA assay evidence was not identified.
BS4 No non-segregation data were identified for this variant, so BS4 cannot be assessed. Details ▾Hide ▴
Evidence considered
  • No segregation data were identified.
Still missing
  • Family non-segregation data were not available.
BP2 No phase data or additional variant data were identified to support BP2. Details ▾Hide ▴
Evidence considered
  • No in-trans or in-cis pairing evidence was identified.
Still missing
  • Phase information was not available.
BP3 No evidence was identified showing that this duplication lies within a repetitive region without known function in a way that would support BP3. Details ▾Hide ▴
Evidence considered
  • No BP3-supporting regional annotation was available.
Still missing
  • Repeat-region annotation relevant to BP3 was not identified.
BP5 No alternate molecular explanation was identified that would allow BP5 to be assessed. Details ▾Hide ▴
Evidence considered
  • No alternate molecular diagnosis data were available.
Still missing
  • Information about another established cause of disease in the same individual was not available.
BP6 No reputable source benign classification was identified for this exact variant. This variant is absent from ClinVar, so BP6 is not met. Details ▾Hide ▴
Evidence considered
  • This variant is absent from ClinVar.
Sources
clinvar ↗
Not applicable · 5· recorded as not applicable Show reasons ▾Hide reasons ▴
PS1 N/APS1 applies to a variant that results in the same amino acid change as an established pathogenic variant. This duplication has an uncertain protein consequence (p.?), so PS1 is not applicable. Details ▾Hide ▴
Evidence considered
  • Protein consequence is currently unresolved.
PM3 N/APM3 is used for recessive disorders with detected variants in trans. The available evidence does not support use of a recessive in-trans framework for this variant. Details ▾Hide ▴
Evidence considered
  • No in-trans recessive case evidence was identified.
PM5 N/APM5 applies to a novel missense change at an amino acid residue where a different pathogenic missense change has been established. This duplication does not have a defined missense consequence, so PM5 is not applicable. Details ▾Hide ▴
Evidence considered
  • No missense consequence is defined for this variant.
PP2 N/APP2 is a missense-specific criterion. This duplication does not have an established missense consequence, so PP2 is not applicable. Details ▾Hide ▴
Evidence considered
  • No missense consequence is defined for this variant.
BP1 N/ABP1 is a missense-specific criterion and is not applicable to this duplication. Details ▾Hide ▴
Evidence considered
  • This variant is not an established missense change.

Identifiers

Gene
DNMT3A
Transcript
NM_022552.4
Coding (HGVS c.)
NM_022552.4:c.856-59_1014+13dup
Protein (HGVS p.)
NP_072046.2:p.?
GRCh38
chr2:25247577 A>ACCCCACAACTTACCACTGAGAATTTGCCGTCTCCGAACCACATGACCCAGCGGGTGCCTTCAGCTGCTCGGCTCCGGCCCGTCATCCACCAAGACACAATGCGGCCTGGCCACCAGGAGAAGCCCCGCAGTTTCCCCCACACCAGCTCCCCAATGCCAAAGCCCCGGCCGTCCTGGAGCCCCAAGGAGCAGAAATCATTACACAGTGGTCACGAGGCCCTGCCACCCTGAT
GRCh37
chr2:25470446 A>ACCCCACAACTTACCACTGAGAATTTGCCGTCTCCGAACCACATGACCCAGCGGGTGCCTTCAGCTGCTCGGCTCCGGCCCGTCATCCACCAAGACACAATGCGGCCTGGCCACCAGGAGAAGCCCCGCAGTTTCCCCCACACCAGCTCCCCAATGCCAAAGCCCCGGCCGTCCTGGAGCCCCAAGGAGCAGAAATCATTACACAGTGGTCACGAGGCCCTGCCACCCTGAT

Gene diagram

Every interpreted variant in DNMT3A, mapped onto the exon structure of NM_022552.4. Select a row to find it on the plot.

DNMT3ANM_022552.4
Fetching transcript structure from UCSC…
gnomAD v4.1 Allele count data not recorded
gnomAD v2.1 Allele count data not recorded

Statements

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

Other predictors

REVEL
Not available
BayesDel
Not available

How the predictions were used

PP3 SupportingSpliceAI predicts a strong splice effect for this variant, with a maximum delta score of 0.91, which is above commonly used concern thresholds and supports an abnormal splicing effect. REVEL and BayesDel were not available because this is not an SNV. Details ▾Hide ▴
Rule
Computational evidence supports a deleterious splicing effect.
Evidence considered
  • SpliceAI max delta score 0.91.
  • Predicted acceptor gain and donor gain signals are high.
Still missing
  • RNA confirmation of the predicted splice effect was not identified.
Sources
spliceai ↗
BP4 Available computational evidence does not support a benign interpretation. SpliceAI predicts a substantial splice effect with a maximum delta score of 0.91, which argues against BP4. Details ▾Hide ▴
Rule
Benign computational evidence is not present.
Evidence considered
  • SpliceAI max delta score 0.91 indicates predicted splice disruption.
Sources
spliceai ↗
BP7 BP7 is not supported because computational evidence predicts splice disruption rather than no impact on splicing. SpliceAI shows a maximum delta score of 0.91. Details ▾Hide ▴
Rule
No-splice-impact computational criterion is not satisfied.
Evidence considered
  • SpliceAI max delta score 0.91.
Sources
spliceai ↗

Statement

In silico

SpliceAI predicts possible splice impact for this variant (max delta score = 0.91).

0 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata.

Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.

gnomAD v4.1 Captured gnomAD v4.1 source record Open source ↗
gnomAD v2.1 Captured gnomAD v2.1 source record Open source ↗
SpliceAI Lookup Captured SpliceAI source record Open source ↗
ClinVar Captured ClinVar source record Open source ↗
COSMIC Captured COSMIC source record Open source ↗

All source links

Statements for reports

The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.

gnomAD v4.1

Absent from gnomAD v4.1.

gnomAD v2.1

Absent from gnomAD v2.1.

ClinVar

This variant is absent from ClinVar.

In silico

SpliceAI predicts possible splice impact for this variant (max delta score = 0.91).

Somatic

This variant has not previously been reported in somatic cancers (COSMIC).