About EZHIP
No gene-level summary was recorded for this case.
Previous versions
Variant interpretation report
EZHIP c.860_892del, p.(Gly287_Pro297del)
Classification
Uncertain significance
Variant description:
No variant summary was recorded for this case.
Five-step scale from benign to pathogenic. This variant is uncertain. Select a step to read what it means.
Uncertain.The recorded classification is uncertain significance.
In plain language
Gene-level background from the recorded interpretation.
Words with a dotted underline have a short definition. Hover or tap them.
LYFE Sciences is an AI system, and it can make mistakes.
Criteria may be applied incorrectly, sources may be misread, and a
confident-looking classification can still be wrong.
Double-check every criterion and its underlying evidence
before relying on any call.
01The reasoning
How it was classified
The recorded framework is Not recorded. The criteria and strengths shown below come from the saved assessment; this page does not recalculate the classification.
Recorded applied criteria
The applied criteria and their strengths are shown as assessed under the stated framework.
Pathogenic evidence criteria: 2
Benign evidence criteria: 0
Pathogenic criteria applied · 2
PM2Supporting
PM2 · supporting
This variant is extremely rare in population databases. gnomAD v2.1 reports an allele frequency of 0.00135% (2/147,648 alleles, 0 homozygotes). gnomAD v4.1 reports 0.00239% (13/544,257 alleles, 0 homozygotes, grpmax FAF = 2.23 × 10⁻⁵). The variant is absent from gnomAD-Canada. All observed frequencies are well below the 0.1% threshold for PM2 under generic ACMG/AMP.
PM4Moderate
PM4 · moderate
NM_203407.3:c.860_892del is an in-frame deletion removing 11 amino acids (p.Gly287_Pro297del) within a non-repeat region of EZHIP. In-frame deletions in non-repeat regions meet PM4 at moderate strength under generic ACMG/AMP. The deleted region spans residues 287–297 in exon 1 with no evidence of being a repetitive domain.
Benign criteria applied · 0
No benign criterion marked as applied in the recorded assessment.
Recorded classification: Uncertain significance
gene-specific framework lacked a usable explicit final combination framework, so generic ACMG/AMP 2015 final-combination rules were applied as fallback; applied criteria: PM2 supporting, PM4 moderate; combination = 1 moderate + 1 supporting, which maps to VUS.
02The sources
Evidence at a glance
Evidence summaries and captured source records, where available. Missing entries should not be interpreted as negative findings.
gnomAD v4.1
gnomAD v2.1
Population frequency
13 / 544,257 alleles
gnomAD v4.1: 13 / 544,257 alleles. Recorded AF 2.38858e-05. Recorded homozygote count 0.
gnomAD v2.1
This variant is present in gnomAD v2.1 (AF= 1.35457e-05; MAF= 0.00135%, 2/147648 alleles, homozygotes = 0) and has highest observed frequency in the East Asian population (AF= 8.30496e-05; MAF= 0.00830%, 1/12041 alleles, homozygotes = 0).
gnomAD-Canada
Absent from gnomAD-Canada v1.0.
SpliceAI score
0.040 maximum delta
Recorded SpliceAI maximum delta score: 0.040. Refer to the recorded PP3/BP4 rationale for interpretation.
No listed criterion applied
SpliceAI ↗
ClinVar submissions
Not recorded
A ClinVar laboratory submission summary was not recorded.
Context only
ClinVar ↗
Functional evidence
Statement recorded
OncoKB did not identify variant-specific reviewed functional evidence for this variant; gene-level curated context is available for reviewer follow-up. EZHIP, a polycomb binding protein, is recurrently altered by rearrangement and mutation in endometrial stromal sarcomas and posterior fossa ependymoma
No listed criterion applied
OncoKB ↗
COSMIC
Cancer Hotspots
Somatic evidence
No matching record reported
This variant has not previously been reported in somatic cancers (COSMIC).
Cancer Hotspots
This variant does not lie in a statistically significant hotspot.
Context only
For specialists
Technical detail
ACMG/AMP criteria under Not recorded, with the data and sources behind each one.
29 criteria with recorded statuses: 2 met · 6 not met · 12 not assessed · 9 not applicable. Open any row for the full reasoning, the rule and the evidence behind it.
Met
Not met
Not assessed
Not applicable
NM_203407.3:c.860_892del (p.Gly287_Pro297del) is an in-frame deletion of 11 amino acids within exon 1 of EZHIP, a gene for which loss-of-function is a supported germline disease mechanism.
This variant is extremely rare in population databases, with an allele frequency of 0.00135% in gnomAD v2.1 (2/147,648 alleles) and 0.00239% in gnomAD v4.1 (13/544,257 alleles), meeting PM2 at supporting strength.
As an in-frame deletion in a non-repeat region, the variant meets PM4 at moderate strength per generic ACMG/AMP criteria.
PVS1 is not applicable as this in-frame deletion does not fall into the null-variant buckets (nonsense, frameshift, or canonical splice) defined by the ClinGen SVI PVS1 framework.
No computational evidence supports pathogenicity (SpliceAI max delta = 0.04; REVEL/BayesDel not applicable to deletions), so PP3 is not met.
The variant is absent from ClinVar, and no functional studies, cosegregation data, or de novo reports were identified. Multiple criteria (PS2, PS3, PS4, PS5, PM6, PP1, PP4, BS2, BS3, BS4, BP2, BP5) remain unassessed due to lack of evidence.
No criteria match.
Met · 2
PM2 SupportingThis variant is extremely rare in population databases. gnomAD v2.1 reports an allele frequency of 0.00135% (2/147,648 alleles, 0 homozygotes). gnomAD v4.1 reports 0.00239% (13/544,257 alleles, 0 homozygotes, grpmax FAF = 2.23 × 10⁻⁵). The variant is absent from gnomAD-Canada. All observed frequencies are well below the 0.1% threshold for PM2 under generic ACMG/AMP. Details ▾Hide ▴
Evidence considered
- gnomAD v2.1: AF = 1.35 × 10⁻⁵ (2/147
- 648 alleles)
- highest subpopulation AF = 8.30 × 10⁻⁵ (East Asian)
- gnomAD v4.1: AF = 2.39 × 10⁻⁵ (13/544
- 257 alleles)
- grpmax FAF = 2.23 × 10⁻⁵
- gnomAD-Canada v1.0: absent
Sources
PM4 ModerateNM_203407.3:c.860_892del is an in-frame deletion removing 11 amino acids (p.Gly287_Pro297del) within a non-repeat region of EZHIP. In-frame deletions in non-repeat regions meet PM4 at moderate strength under generic ACMG/AMP. The deleted region spans residues 287–297 in exon 1 with no evidence of being a repetitive domain. Details ▾Hide ▴
Evidence considered
- In-frame deletion of 11 amino acids (Gly287 to Pro297) in a non-repeat region.
Sources
Not met · 6 · evaluated, threshold not reached
PM1 This variant does not lie in a statistically significant mutational hotspot. Hotspot analysis returned no significance for the deleted region. No gene-specific functional domain mapping is available for PM1 adjudication. Details ▾Hide ▴
Evidence considered
- Hotspot analysis: variant not in a statistically significant hotspot
- exact variant not listed in known hotspot catalog.
Still missing
- No gene-specific functional domain mapping available to assess PM1 for this gene.
PP3 No computational evidence supports a deleterious effect. SpliceAI predicts no significant splice impact (max delta = 0.04). REVEL and BayesDel are not applicable to in-frame deletions. HCI prior is not supported for EZHIP. No in silico protein structure tools assessed. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta = 0.04 (no significant splice impact)
- REVEL/BayesDel not applicable to deletions
- HCI prior not available for EZHIP
Still missing
- No protein-level in silico tools applied to assess in-frame deletion impact.
Sources
BA1 The highest observed population allele frequency for this variant is 8.30 × 10⁻⁵ in gnomAD v2.1 (East Asian), well below the BA1 threshold of >1%. Details ▾Hide ▴
Evidence considered
- gnomAD v2.1 max subpopulation AF = 8.30 × 10⁻⁵ (East Asian)
- gnomAD v4.1 grpmax FAF = 2.23 × 10⁻⁵
Sources
BS1 The highest observed population allele frequency for this variant is 8.30 × 10⁻⁵ in gnomAD v2.1 (East Asian), well below the BS1 threshold of >0.3%. Details ▾Hide ▴
Evidence considered
- gnomAD v2.1 max subpopulation AF = 8.30 × 10⁻⁵ (East Asian)
- gnomAD v4.1 max subpopulation AF = 3.99 × 10⁻⁵ (European non-Finnish)
Sources
BP3 This in-frame deletion spans residues 287–297 in exon 1 of EZHIP. There is no evidence confirming this region is a repetitive domain without known function. The deleted sequence contains GC-rich motifs but is not established as a functionally inert repetitive region. Details ▾Hide ▴
Evidence considered
- Deleted region (residues 287–297) not confirmed to be a repetitive region without known function.
Still missing
- No functional annotation confirming the deleted region is a non-functional repetitive domain.
BP4 SpliceAI predicts no significant splice impact (max delta = 0.04). However, this is an in-frame deletion whose primary effect is at the protein level, and no protein-level computational tools (e.g., for structural impact of in-frame deletions) were applied. The single line of evidence (SpliceAI) is insufficient to meet BP4. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta = 0.04 (no significant splice impact). No protein-level in silico evidence of benign impact available.
Still missing
- Protein-level in silico assessment not available for in-frame deletions.
Sources
Not assessed · 12 · no assessment recorded
PS2 No de novo data available. No publications reporting de novo occurrence of this variant were identified. Details ▾Hide ▴
Still missing
- No de novo reports available for this variant.
PS3 No variant-specific functional studies identified. OncoKB classifies this variant as 'Unknown Oncogenic Effect' and no literature with functional evidence for this variant was found. Details ▾Hide ▴
Evidence considered
- OncoKB reports no reviewed functional evidence for this variant.
Still missing
- No well-established functional studies available for this variant.
Sources
PS4 No case-control or prevalence data available. The variant is absent from ClinVar and no affected-vs-control population data were identified. Details ▾Hide ▴
Still missing
- No case-control or prevalence studies available.
PM6 No de novo data available. No publications reporting de novo occurrence of this variant were identified. Details ▾Hide ▴
Still missing
- No de novo reports available for this variant.
PP1 No cosegregation data available. No family studies reporting this variant were identified. Details ▾Hide ▴
Still missing
- No cosegregation or family data available.
PP4 No patient phenotype or clinical data were provided for this case. Details ▾Hide ▴
Still missing
- No patient phenotype data available to assess disease specificity.
BS2 This variant is observed at extremely low frequency in gnomAD (2 of 147,648 alleles in v2.1; 13 of 544,257 alleles in v4.1) with zero homozygotes. However, carrier phenotype data are not available, and EZHIP is on the X chromosome, which complicates BS2 assessment without knowing whether carriers were healthy adult hemizygous males or heterozygous females with full penetrance expected early. Details ▾Hide ▴
Evidence considered
- gnomAD v2.1: 2 carriers
- 0 homozygotes
- gnomAD v4.1: 13 carriers
- No carrier phenotype data available
Still missing
- Carrier phenotype data not available
- X-linked inheritance context requires clinical correlation.
Sources
BS3 No well-established functional studies showing no deleterious effect are available for this variant. Details ▾Hide ▴
Still missing
- No functional studies available.
BS4 No segregation data available. No family studies reporting lack of segregation with disease were identified. Details ▾Hide ▴
Still missing
- No segregation or family data available.
BP2 No data available on whether this variant has been observed in trans with a pathogenic variant or in cis with a pathogenic variant. EZHIP is X-linked, which further limits standard BP2 assessment. Details ▾Hide ▴
Still missing
- No co-occurrence data available
- X-linked context limits trans assessment.
BP5 No evidence of an alternate molecular basis for disease was identified in this case. Details ▾Hide ▴
Still missing
- No alternate molecular basis data available.
PS5 No evidence of this variant occurring in trans with a pathogenic variant. EZHIP is X-linked, further complicating trans analysis. Details ▾Hide ▴
Still missing
- No trans configuration data available.
Not applicable · 9· recorded as not applicable Show reasons ▾Hide reasons ▴
PVS1 N/ANM_203407.3:c.860_892del is an in-frame deletion (p.Gly287_Pro297del) removing 11 amino acids. This variant does not fall into any ClinGen SVI PVS1 null-variant bucket (nonsense, frameshift, or canonical ±1,2 splice consensus). Generic PVS1 framework is not applicable to in-frame deletions. Details ▾Hide ▴
Evidence considered
- Variant is an in-frame deletion
- not a null variant per ClinGen PVS1 criteria (PMC6185798).
Sources
PS1 N/AVariant is absent from ClinVar with no prior pathogenic or likely pathogenic classification by any submitter. No same-variant classification exists to apply PS1. Details ▾Hide ▴
Evidence considered
- ClinVar search returned no variation IDs
- no submissions
- and no classifications for this variant.
Sources
PM3 N/APM3 (trans with pathogenic variant in recessive disorder) skipped per user directive. Details ▾Hide ▴
No further detail was recorded.
PM5 N/APM5 applies to missense variants at the same residue as a known pathogenic missense change. This variant is an in-frame deletion, not a missense substitution, and cannot be evaluated under the classic same-residue PM5 framework. Details ▾Hide ▴
Evidence considered
- Variant is an in-frame deletion
- PM5 candidate harvesting returned no eligible comparators.
Sources
pm5_candidates
PP2 N/APP2 applies to missense variants in genes with a low rate of benign missense variation. This variant is an in-frame deletion, not a missense substitution. Details ▾Hide ▴
Evidence considered
- Variant is an in-frame deletion
- not a missense variant.
PP5 N/AThis variant is absent from ClinVar. No expert panel or reputable source has classified this variant, and no VCEP/CSPEC exists for EZHIP. Details ▾Hide ▴
Evidence considered
- ClinVar reports no classification for this variant from any submitter or expert panel.
Sources
BP1 N/ABP1 applies to missense variants in genes where primarily truncating variants cause disease. This variant is an in-frame deletion, not a missense substitution. Details ▾Hide ▴
Evidence considered
- Variant is an in-frame deletion
- not a missense variant.
BP6 N/AThis variant is absent from ClinVar with no reputable source classifying it as benign or likely benign. Details ▾Hide ▴
BP7 N/ABP7 applies to synonymous variants with no predicted splice impact. This variant is an in-frame deletion, not a synonymous substitution. Details ▾Hide ▴
Evidence considered
- Variant is an in-frame deletion
- not a synonymous variant.
Identifiers
- Gene
- EZHIP
- Transcript
- NM_203407.3
- Coding (HGVS c.)
- NM_203407.3:c.860_892del
- Protein (HGVS p.)
- NP_981952.1:p.(Gly287_Pro297del)
- GRCh38
- chrX:51407860 TGCGATTCTGCGCCAGGCCCTGCCCGCCGAGGCC>T
- GRCh37
- chrX:51150712 TGCGATTCTGCGCCAGGCCCTGCCCGCCGAGGCC>T
Gene diagram
Every interpreted variant in EZHIP, mapped onto the exon structure of NM_203407.3. Select a row to find it on the plot.
EZHIPNM_203407.3
Fetching transcript structure from UCSC…
Exons
—
Transcript span
—
Strand
—
Variants mapped
—
Source
UCSC ncbiRefSeqCurated
All variants in EZHIP
—
Select a row to find it on the plot; use the link to open its page.
| Protein | Location | Classification | Link |
|---|
gnomAD v4.1
13 / 544,257 alleles
AF 2.39e-05 · 0 homozygotes · FAF 2.23e-05
gnomAD v2.1
2 / 147,648 alleles
AF 1.35e-05 · 0 homozygotes
gnomAD-Canada v1.0
Allele count data not recorded
By genetic ancestry
gnomAD v4.1
AF 2.4e-05 · 13 / 544,257 alleles · 0 hom · FAF 2.2e-05
| European (non-Finnish)12 / 300,388 | 4e-05 |
| East Asian1 / 29,804 | 3.4e-05 |
0 alternate alleles recorded in 8 other groups: Remaining individuals, Admixed American, European (Finnish), Amish, Middle Eastern, South Asian, Ashkenazi Jewish, African/African American.
gnomAD v2.1
AF 1.4e-05 · 2 / 147,648 alleles · 0 hom
| East Asian1 / 12,041 | 8.3e-05 |
| European (non-Finnish)1 / 62,387 | 1.6e-05 |
0 alternate alleles recorded in 6 other groups: African/African American, Admixed American, Ashkenazi Jewish, European (Finnish), Remaining individuals, South Asian.
Statements
gnomAD v4.1
This variant is present in gnomAD v4.1 (AF= 2.38858e-05; MAF= 0.00239%, 13/544257 alleles, homozygotes = 0) and has highest observed frequency in the European (non-Finnish) population (AF= 3.99483e-05; MAF= 0.00399%, 12/300388 alleles, homozygotes = 0); grpmax FAF= 2.228e-05.
gnomAD v2.1
This variant is present in gnomAD v2.1 (AF= 1.35457e-05; MAF= 0.00135%, 2/147648 alleles, homozygotes = 0) and has highest observed frequency in the East Asian population (AF= 8.30496e-05; MAF= 0.00830%, 1/12041 alleles, homozygotes = 0).
gnomAD-Canada
Absent from gnomAD-Canada v1.0.
SpliceAI and Pangolin
Other predictors
- REVEL
- Not available
- BayesDel
- Not available
How the predictions were used
PP3 No computational evidence supports a deleterious effect. SpliceAI predicts no significant splice impact (max delta = 0.04). REVEL and BayesDel are not applicable to in-frame deletions. HCI prior is not supported for EZHIP. No in silico protein structure tools assessed. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta = 0.04 (no significant splice impact)
- REVEL/BayesDel not applicable to deletions
- HCI prior not available for EZHIP
Still missing
- No protein-level in silico tools applied to assess in-frame deletion impact.
Sources
BP4 SpliceAI predicts no significant splice impact (max delta = 0.04). However, this is an in-frame deletion whose primary effect is at the protein level, and no protein-level computational tools (e.g., for structural impact of in-frame deletions) were applied. The single line of evidence (SpliceAI) is insufficient to meet BP4. Details ▾Hide ▴
Evidence considered
- SpliceAI max delta = 0.04 (no significant splice impact). No protein-level in silico evidence of benign impact available.
Still missing
- Protein-level in silico assessment not available for in-frame deletions.
Sources
BP7 N/ABP7 applies to synonymous variants with no predicted splice impact. This variant is an in-frame deletion, not a synonymous substitution. Details ▾Hide ▴
Evidence considered
- Variant is an in-frame deletion
- not a synonymous variant.
Statement
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.04).
0 paper records listed. No publication is explicitly linked to an applied criterion in the recorded metadata.
Screenshots represent source records captured during evidence collection. Select one to view the recorded source content.
gnomAD v4.1
13 / 544,257 recorded alleles
Open source ↗
gnomAD v2.1
Captured gnomAD v2.1 source record
Open source ↗
SpliceAI Lookup
Recorded maximum delta 0.040
Open source ↗
ClinVar
Captured ClinVar source record
Open source ↗
COSMIC
Captured COSMIC source record
Open source ↗
Cancer hotspots
Captured Cancer Hotspots source record
Open source ↗
OncoKB
Captured OncoKB source record
Open source ↗
All source links
- ClinVar ↗www.ncbi.nlm.nih.gov/clinvar/?term=NM_203407.3%3Ac.860_892delGC…
- gnomAD v2.1 ↗gnomad.broadinstitute.org/variant/X-51150712-TGCGATTCTGCGCCAGGC…
- gnomAD v4.1 ↗gnomad.broadinstitute.org/variant/chrX-51407860-TGCGATTCTGCGCCA…
- gnomAD-Canada ↗http://192.168.4.76:8001/variant/X-51407860-TGCGATTCTGCGCCAGGCC…
- SpliceAI Lookup ↗spliceailookup.broadinstitute.org/#variant=NM_203407.3%3Ac.860_…
- OncoKB ↗www.oncokb.org/gene/EZHIP/G287_P297del
- COSMIC ↗cancer.sanger.ac.uk/cosmic/search?q=EZHIP+c.860_892del
- Cancer hotspots ↗www.cancerhotspots.org/
Statements for reports
The evidence statements recorded by the interpretation pipeline. They have not been reinterpreted by the page.
gnomAD v4.1
This variant is present in gnomAD v4.1 (AF= 2.38858e-05; MAF= 0.00239%, 13/544257 alleles, homozygotes = 0) and has highest observed frequency in the European (non-Finnish) population (AF= 3.99483e-05; MAF= 0.00399%, 12/300388 alleles, homozygotes = 0); grpmax FAF= 2.228e-05.
gnomAD v2.1
This variant is present in gnomAD v2.1 (AF= 1.35457e-05; MAF= 0.00135%, 2/147648 alleles, homozygotes = 0) and has highest observed frequency in the East Asian population (AF= 8.30496e-05; MAF= 0.00830%, 1/12041 alleles, homozygotes = 0).
gnomAD-Canada
Absent from gnomAD-Canada v1.0.
ClinVar
This variant is absent from ClinVar.
In silico
SpliceAI predicts no significant splice impact for this variant (max delta score = 0.04).
Functional
OncoKB did not identify variant-specific reviewed functional evidence for this variant; gene-level curated context is available for reviewer follow-up. EZHIP, a polycomb binding protein, is recurrently altered by rearrangement and mutation in endometrial stromal sarcomas and posterior fossa ependymoma
Somatic
This variant does not lie in a statistically significant hotspot. This variant has not previously been reported in somatic cancers (COSMIC).
Cancer Hotspots
This variant does not lie in a statistically significant hotspot.